Introduction

Welcome to the insect R package, a pipeline for the analysis of next generation sequencing (NGS) amplicon libraries using informatic sequence classification trees. The pipeline employs a machine-learning approach that uses a set of training sequences from GenBank and other databases to ‘learn’ a classification tree, which is then used to assign taxonomic IDs to a set of query sequences generated from an NGS platform such as Illumina MiSeq. The package also includes a suite of functions for FASTQ/FASTA sequence parsing, de-multiplexing, paired-end read stitching, primer trimming, quality filtering, de-replication, re-replication, and many more useful operations. These functions are designed for use on workstations with multiple processors, but can also be used on standard laptop and desktop computers provided the user doesn’t mind waiting a little longer for the results. While not a prerequisite, the pipeline is designed to be used in conjunction with the ape package (Paradis et al., 2004; Paradis, 2012), which contains a memory-efficient binary format for DNA (the “DNAbin” object type) among many other useful features. The insect package is ideal for processing both environmental DNA (eDNA) meta-barcode libraries and single-source NGS/Sanger amplicon sequences.

The most time-consuming stage of the workflow generally involves building the classification tree. For example, a training dataset consisting of 300,000 × 300bp COI sequences recently took around one week to learn on a workstation with 48 logical processors (2.3GHz) and 64 GB RAM. The insect classification trees are amplicon specific, so a unique tree is generally required for each primer set. However, trees are already available for some of the more commonly used barcoding primers here (it may be necessary to right-click on the link and open it in a new tab/window). The package also includes functions and instructions for downloading and filtering training data from sequence databases such as GenBank (including a “virtual PCR” tool and a quality filter for lineage metadata) and carrying out the tree-learning operation, though these methods are beyond the scope of this introductory tutorial. New trees are constantly being added to the collection, so please feel free to suggest a barcoding primer set with which to generate a tree and we will endeavor to add it to the list.

To produce a classification tree, a set of training sequences is first obtained from GenBank and/or other databases where accurate lineage metadata are available. The training data are filtered to remove those with erroneous metadata, and trimmed to retain only the region of interest using the virtualPCR function (sequences that do not span the entire region of interest are removed). the learn function then recursively partitions the training sequences (a top-down/divisive approach as opposed to bottom-up/agglomerative methods such as UPGMA and neighbor-joining). The dataset is initially divided in two, and a profile hidden Markov model is derived for each subset for downstream classification of query sequences (see Durbin et al. (1998) for a detailed description of these models). The lowest common taxonomic rank of each subset is also stored at each new node, also for downstream query sequence classification. The partitioning and model training procedure then continues recursively, splitting the training data into smaller and smaller subsets while adding new nodes to the classification tree.

Once a classification tree has been loaded, query sequences obtained from the specified primer set can be classified to produce taxonomic IDs with an associated degree of confidence. The classification algorithm works as follows: starting from the root node of the classification tree, the likelihood of the query sequence (the log-probability of the sequence given a particular model) is computed for each of the models at the child nodes using the forward algorithm (see Durbin et al. (1998)). The competing likelihood values are then compared by computing their Akaike weights (see Johnson and Omland, 2004). If one model is overwhelmingly more likely to have produced the sequence than the other, that child node is chosen and the classification is updated to reflect the taxonomic ID stored at the node.

This classification procedure is repeated, continuing down the tree until either an inconclusive result is returned by a model comparison test (i.e. the Akaike weight is lower than a pre-defined threshold, usually 0.9), or a terminal leaf node is reached, at which point a species-level classification is generally returned. The algorithm outputs a taxonomic ID (as a semicolon-delimited lineage string) and the Akaike weight of the model at the final node. Note that the default behavior is for the Akaike weight to ‘decay’ as it moves down the tree, by computing the cumulative product of all preceding Akaike weight values. This is perhaps an overly conservative approach, but it minimizes the chance of generating type I errors.

In addition to the two key functions learn and classify, the package includes several tools to encode the entire work-flow from raw sequence data input to tabular output. At any stage during the process, users can export the sequence data using the functions writeFASTA and writeFASTQ.

A worked example

This tutorial will gently guide users through the workflow using an example dataset of COI sequences derived from Autonomous Reef Monitoring Structures (ARMS) in Timor-Leste, amplified using the metazoan COI barcoding primers mlCOIintF and jgHCO2198 (GGWACWGGWTGAACWGTWTAYCCYCC and TAIACYTCIGGRTGICCRAARAAYCA, respectively; Leray et al. (2013)).

First download and install the latest development version of the insect package by following the instructions in the package README here (as above, it may be necessary to right-click on these links and open them in a new tab/window). Then load the package by running

library(insect)

A zip archive containing three example FASTQ files is available here. These files contain a subset of 1000 forward and reverse reads from one sample and the same number of pre-stitched reads from another. This will provide an opportunity to demonstrate the workflow for both of these commonly-encountered input data formats. The marine COI classification tree and its training sequence dataset is stored as a ~40 Mb RData file here. First, download both sources and extract the contents of the zip archive to the working directory alongside the RData file. This can either be done manually or from within R using the following code:

## fastq files
URL1 <- "https://www.dropbox.com/s/71ixehy8e51etdd/insect_tutorial1_files.zip?dl=1"
download.file(URL1, destfile = "insect_tutorial1_files.zip", mode = "wb")
unzip("insect_tutorial1_files.zip")
file.remove("insect_tutorial1_files.zip")

## classification tree
URL2 <- "https://www.dropbox.com/s/m0on8ykooa9buoz/mlCOIintF_jgHCO2198_marine.RData?dl=1"
download.file(URL2, destfile = "mlCOIintF_jgHCO2198_marine.RData", mode = "wb")

The FASTQ files are then read into R as either concatenated upper-case character strings or binary “DNAbin” objects, with “quality” attributes. In this example we will opt for the former by setting bin = FALSE, since the character strings are perhaps a little more intuitive for beginners. Intermediate/advanced users who are familiar with the ape package may prefer to work with “DNAbin” objects by retaining the default setting of bin = TRUE. One important difference to note is that subsetting the character vector (e.g. with square brackets) will result in the “quality” attributes being lost, while this isn’t an issue with DNAbin list objects, whose quality scores are attributed to each sequence individually.

S1R1 <- readFASTQ("COI_sample1_read1.fastq", bin = FALSE)
S1R2 <- readFASTQ("COI_sample1_read2.fastq", bin = FALSE)
S2 <- readFASTQ("COI_sample2.fastq", bin = FALSE)

The S1R1 and S1R2 vectors are the same length, and have the same names apart from a single digit that specifies the read number. The first sequence of each object can be viewed as follows:

S1R1[1]
#>                                                                                                                                                                                                                       M...1:1101:26420:11409 1:N:0:1 
#> "GTTCTTTAAATTTTATGACGACTTTGTTTAATATAAAAACTAAGAGGTGGAATATGTTTATAATACCTCTTTTTTGTTGAACAGTGTTGGTAACTACGTTGTTGTTGTTACTTTCTTTGCCAGTTTTGGCTGCTGCCATCACTATGTTGTTATTTGATCGTAATTTTAATACTTCTTTTTTTGATCCAGCTAGAGGAGGAGATCCAGTACTATATCAGCATTTGTTTTGATTCTTCGGCCAT"
S1R2[1]
#>                                                                                                                                                                                                                       M...1:1101:26420:11409 2:N:0:1 
#> "ATGGCCGAAGAATCAAAACAAATGCTGATATAGTACTGGATCTCCTCCTCTAGCTGGATCAAAAAAAGAAGTATTAAAATTACGATCAAATAACAACATAGTGATGGCAGCAGCCAAAACTGGCAAAGAAAGTAACAACAACAACGTAGTTACCAACACTGTCCAACAAAAAAGAGGTATTATAAACATATTCCACCTCTTAGTTTTTATATTAAACAAAGTCGTCATAAAATTTAAAGAAC"

The next step is to stitch the forward and reverse reads from sample 1 together to create a single vector of sequences, similar to sample 2. The stitch function performs this operation, as well as optionally removing any sequences that don’t contain the primer sequences in either direction, trimming the primers from those that do, and outputting all sequences in the 5’ -> 3’ orientation. The optional primer filter-trim and sequence orientation is activated by passing the primer sequences to the stitch function (again either as character strings or “DNAbin” objects).

mlCOIintF <- "GGWACWGGWTGAACWGTWTAYCCYCC"
jgHCO2198 <- "TAIACYTCIGGRTGICCRAARAAYCA"
S1 <- stitch(S1R1, S1R2, up = mlCOIintF, down = jgHCO2198)

Of the original 1000 sequences, 289 were retained and stitched for sample 1.

The sample 2 sequences were pre-stitched on the Illumina platform but still have their primers attached. Here, we will use the trim function to discard any sequences that don’t contain both of the primer sequences (in either direction), orientate all sequences in the 5’ -> 3’ direction, and trim the primer sequences from each end:

S2 <- trim(S2, up = mlCOIintF, down = jgHCO2198)

The sequences from both samples now need further filtering to remove low-quality reads, ambiguous base calls, singletons and overly short/long sequences. The function qfilter is a quality control function that can be used to apply any or all of these filters. The default behavior is to remove any sequences with a mean quality score of less than 30, those that contain at least one ambiguous base call, those that appear only once in the dataset, and those with length outside the range of 50 - 500 nucleotides (inclusive). To disable any of the filters, simply set the parameter value to NULL. In this example we will stick with the default settings, except that we will change the acceptable length range to 250 - 350 bp.

S1 <- qfilter(S1, minlength = 250, maxlength = 350)
S2 <- qfilter(S2, minlength = 250, maxlength = 350)

This has whittled sample 1 down to 144 sequences and sample 2 down to 181. For the purposes of this exercise we will reduce the dataset down even further by subsetting out the duplicate sequences. Note that this won’t result in a significant speedup, since the classify function automatically de-replicates and re-replicates the sequence set before and after classification anyway. It will just provide us with a simplified output to interpret for the tutorial.

S1 <- dereplicate(S1)
S2 <- dereplicate(S2)

Note that we use dereplicate instead of unique here since the latter would strip the sequence names, which will be useful for downstream analysis. The dereplicate function also stores the information necessary to re-replicate the sequence set at a later time if needed (with the exception of “quality” attributes). For samples 1 and 2 respectively we now have 13 and 55 unique, high quality sequences that occur more than once in each dataset, are between 250 and 350 nucleotides long, and are free of ambiguous base calls.

The final step is to load the classification tree and run the classify function to assign taxonomic IDs and associated Akaike weight confidence scores (between 0 and 1, with anything over 0.9 signifying strong confidence). First, load the RData bundle containing the classification tree (“tree”), the training dataset used to learn the tree (“z”), the NCBI taxonomy reference database (“taxonomy”) and the two primer sequences (“primers”).

load("mlCOIintF_jgHCO2198_marine.RData")

The classify function may take a minute or two to process these sequences, since it uses a computationally intensive dynamic programming algorithm to find their likelihood values at each node of the classification tree (the exception is when the argument ping is set to TRUE and there is an exact match between the query sequence and at least one of the sequences in the training dataset, in which case the function simply returns the common ancestor of the matching sequences and a score of 1). This function is also able to be run in parallel by setting the cores argument to 2 or more depending on the number available (tip: run parallel::detectCores() if you are unsure). Classification times vary, and depend on several factors including the number of unique sequences in the dataset, the size of the tree, the length of the input sequences, the processing speed, the number of processors used, etc. The average time for classifying COI sequences using the tree above is approximately 3 - 4 seconds per unique sequence per processor. For example, a dataset containing 1000 unique sequences would take around an hour on a single processor, half an hour on two, etc. It is worth noting that over-specifying the number of cores can have an adverse effect on efficiency due to the extra time taken to initialize the cluster. In this very small example (68 unique sequences) the optimal number of cores is probably around 4, beyond which the addition of extra cores becomes counter-productive.

The classify function can accept a single sequence (either as a character string or a DNAbin vector), a vector of character strings, a DNAbin list, a list of character string vectors (one vector for each sample) or a list of DNAbin list objects (one DNAbin object for each sample). In this case we will go for the second-to-last option, and bundle the two character vectors together in a list. This will make it easier to tabulate the results following the classification procedure.

x <- list(sample1 = S1, sample2 = S2)
y <- classify(x, tree, cores = 4)
## inspect the output
cat(y$sample2[1:5], sep = "\n")
#> Eukaryota
#> Eukaryota; Opisthokonta; Metazoa; Eumetazoa; Bilateria; Protostomia
#> Eukaryota; Opisthokonta; Metazoa; Eumetazoa; Bilateria; Protostomia; Ecdysozoa; Panarthropoda; Arthropoda; Mandibulata; Pancrustacea; Crustacea; Maxillopoda; Copepoda; Neocopepoda; Podoplea
#> Eukaryota; Opisthokonta; Metazoa; Eumetazoa
#> Eukaryota; Opisthokonta; Metazoa; Eumetazoa; Bilateria; Protostomia
attr(y$sample2, "score")[1:5]
#> [1] 0.9985244 0.9181102 0.9595144 0.9987309 0.9879474

The function produces a list the same length as the input object. Each list element is a character vector giving the taxonomic IDs of the sequences (as semicolon-delimited character strings), which also has a “score” attribute, providing the Akaike weight for each classification. As shown in the above example, some of the sequences simply returned ‘Eukaryota’ as the taxonomic ID, which doesn’t seem very informative; however this is a fairly typical feature of eDNA datasets that can contain a large number of sequences that are highly dissimilar to anything in the reference databases. Of course some sequences may have come from cryptic species that are completely new to science, but in the majority of cases these inconclusive results are probably just pseudo-genes, chimeras and other PCR artifacts. It should be noted that in some situations even previously documented sequences can score similarly against both HMMs at a top-level node, and hence produce an inconclusive classification. This may be circumvented by reducing the threshold parameter or setting decay = FALSE; however, users are advised against the excessive relaxation of these parameters since it may increase the chance of returning spurious classifications (extremely rare using the conservative default values of 0.9 and TRUE, respectively). Further testing and optimization may help to address some of these ‘best practice’ considerations, and will be a focus of future research.

The final step in the process is to convert the list of classifications into a tidy rectangular output table that can be written to a csv or xlsx file. The tabulize function takes the output from classify and produces a data frame with specified taxonomic ranks (passed via the ranks argument) using the NCBI taxonomy reference database. The function also tabulates the sequence counts to a separate column for each site. The default option produces a table with one row for each unique sequence; however the table can be aggregated to produce one row for each unique taxonomic ID by specifying aggregated = TRUE. This option outputs a much shorter table, but certain information such as sequence names and Akaike weights are lost. For example:

shortDF <- tabulize(y, db = taxonomy, aggregated = TRUE)

produces the following output:

taxID taxon rank kingdom phylum class order family genus species n_unique sample1 sample2
2759 Eukaryota superkingdom 20 2 19
2763 Rhodophyta no rank 2 1 1
2806 Florideophyceae class Florideophyceae 1 0 1
6042 Demospongiae class Metazoa Porifera Demospongiae 1 1 0
6072 Eumetazoa no rank Metazoa 1 0 1
6820 Peracarida superorder Metazoa Arthropoda Malacostraca 1 0 1
6821 Amphipoda order Metazoa Arthropoda Malacostraca Amphipoda 1 0 1
7720 Stolidobranchia order Metazoa Chordata Ascidiacea Stolidobranchia 2 2 0
33154 Opisthokonta no rank 1 0 1
33208 Metazoa kingdom Metazoa 4 2 2
33213 Bilateria no rank Metazoa 8 4 4
33317 Protostomia no rank Metazoa 16 0 16
116569 Neocopepoda infraclass Metazoa Arthropoda Maxillopoda 1 0 1
116571 Podoplea superorder Metazoa Arthropoda Maxillopoda 5 0 5
122238 Syllidae family Metazoa Annelida Polychaeta Phyllodocida Syllidae 1 0 1
1336888 Terpios gelatinosa species Metazoa Porifera Demospongiae Suberitida Terpios Terpios gelatinosa 1 1 0
10284388 Clytia simplex species Metazoa Cnidaria Hydrozoa Leptothecata Campanulariidae Clytia Clytia simplex 1 1 0

Finally, the full data frame including sequence names and scores can be tabulated by running

longDF <- tabulize(y, db = taxonomy, aggregated = FALSE)

and output to a csv file using write.csv.

This basic introduction to the insect package has outlined the steps involved in parsing paired-end NGS data, and filtering, trimming primers, de-replication, and taxonomic identification using a pre-built classification tree. The next tutorial in the series will deal with downloading and curating a primer-specific local sequence database and using it to build a classification tree.

The insect package is released under the GPL-3 license, and is free to distribute under certain conditions; however it comes with no warranty. Please direct bug reports to the GitHub issues page

Acknowledgements

This software was developed with funding from a Rutherford Foundation Postdoctoral Research Fellowship from the Royal Society of New Zealand. Thanks to Molly Trimmers for helpful discussion and sharing COI data, and to Danyl McLauchlan and Dinindu Senanayake for assistance with high performance computing facilities.

References

Durbin,R. et al. (1998) Biological Sequence Analysis: Probabilistic Models of Proteins and Nucleic Acids. Cambridge University Press, Cambridge.

Johnson,J.B. and Omland,K.S. (2004) Model selection in ecology and evolution. Trends in Ecology and Evolution, 19, 101–108.

Leray,M. et al. (2013) A new versatile primer set targeting a short fragment of the mitochondrial COI region for metabarcoding metazoan diversity: application for characterizing coral reef fish gut contents. Frontiers in Zoology, 10, 34.

Paradis,E. (2012) Analysis of Phylogenetics and Evolution with R. Second Edition. Springer, New York.

Paradis,E. et al. (2004) APE: analyses of phylogenetics and evolution in R language. Bioinformatics, 20, 289–290.