The hardware and bandwidth for this mirror is donated by METANET, the Webhosting and Full Service-Cloud Provider.
If you wish to report a bug, or if you are interested in having us mirror your free-software or open-source project, please feel free to contact us at mirror[@]metanet.ch.

To style a model, you can either m_add_style() or m_set_style(), which will either add styling to what is already in the scene, or overwrite the styling for the selection in the call. The m_style_surface() and m_style_label() must be used inside m_add_surface() and m_add_label() functions, and cannot be supplied inside the m_set_style() or m_add_style().

By default, the line styling is applied when a new model is added to the scene. If you don’t want the line styling, use m_set_style() after adding a model to the scene.

Some styles have additional, more advanced options that involve javascript, details for all of this can be found in the documentation for 3dmol.js.

library(r3dmol)
model <- r3dmol() %>% 
  m_add_model(data = pdb_6zsl) %>% 
  m_set_style(style = m_style_cartoon()) %>% 
  m_zoom_to()

model

Style Options

All of the styling functions have multiple options. These vary, depending on the style chosen but are all described in the function documentation.

model %>% 
  m_set_style(style = m_style_cartoon(color = 'spectrum', ribbon = TRUE)) %>% 
  m_add_outline() %>% 
  m_set_zoom_limits(upper = 200, lower = 30)

Multiple styles can be supplied by placing multiple styles inside c() into the style parameter.

model %>%
  m_set_style(style = c(
    m_style_cartoon(
      color = "spectrum",
      ribbon = TRUE
    ),
    m_style_line()
  )) %>% 
  m_add_surface(
    atomsel = m_sel(chain = "A"), 
    style = m_style_surface(opacity = 0.9)
  ) %>% 
  m_add_outline()

Using Selections

In order to selectively apply styling to a model, usage of the m_sel() function allows specification of particular atoms to apply the style to.

The m_sel() is a generic selection function, and can be used anywhere that a selection is required. Common selection criteria are:

More selection options are available in the m_sel() documentation.

model %>%
  m_add_style(
    style = c(
      m_style_stick(),
      m_style_sphere(scale = 0.3)
    ),
    sel = m_sel(resi = 1:10, 
                chain = "A", )
  ) %>%
  m_zoom_to(sel = m_sel(resi = 1:10, chain = "A"))

Single Points in Space

Selections can be supplied for functions that require a single point. The center of the overall selection will be found, and that value used in the function.

In the example below, when adding the start and end points for the line, the chain is specified (but the middle-point of all 10 residues is found and used).

When adding the label, the middle of residues 1-10 from both chains is found, and that is where the label is placed.

model %>%
  m_add_style(
    sel = m_sel(resi = 1:10),
    style = c(
      m_style_stick(),
      m_style_sphere(scale = 0.3)
    )
  ) %>%
  m_add_line(
    start = m_sel(
      resi = 1:10,
      chain = "A"
    ),
    end = m_sel(
      resi = 1:10,
      chain = "B"
    ), 
    dashed = TRUE
  ) %>%
  m_add_label(
    text = "The middle of the selection",
    sel = m_sel(resi = 1:10), 
    style = m_style_label(borderColor = "green", 
                          borderThickness = 1, 
                          inFront = FALSE)
  )

Loading Functions

Models can be fetched from the PDB database using m_fetch_pdb().

Models from the common structural analysis and bioinformatics package {bio3d} can be add with the m_bio3d() function.

model <- r3dmol() %>% 
  m_add_model(data = m_fetch_pdb("1bna", save.pdb = FALSE)) %>% 
  m_set_style(style = m_style_cartoon()) %>% 
  m_zoom_to()
model

Obtaining package through bio3d, then reading into r3dmol.

library(bio3d)
pdb <- read.pdb("1bna") 
##   Note: Accessing on-line PDB file
pdb
## 
##  Call:  read.pdb(file = "1bna")
## 
##    Total Models#: 1
##      Total Atoms#: 566,  XYZs#: 1698  Chains#: 2  (values: A B)
## 
##      Protein Atoms#: 0  (residues/Calpha atoms#: 0)
##      Nucleic acid Atoms#: 486  (residues/phosphate atoms#: 24)
## 
##      Non-protein/nucleic Atoms#: 80  (residues: 80)
##      Non-protein/nucleic resid values: [ HOH (80) ]
## 
##    Nucleic acid sequence:
##       CGCGAATTCGCGCGCGAATTCGCG
## 
## + attr: atom, xyz, seqres, calpha, remark,
##         call
model2 <- r3dmol() %>% 
  m_add_model(data = m_bio3d(pdb)) %>% 
  m_set_style(style = m_style_cartoon()) %>% 
  m_zoom_to()

model2

These binaries (installable software) and packages are in development.
They may not be fully stable and should be used with caution. We make no claims about them.