The hardware and bandwidth for this mirror is donated by METANET, the Webhosting and Full Service-Cloud Provider.
If you wish to report a bug, or if you are interested in having us mirror your free-software or open-source project, please feel free to contact us at mirror[@]metanet.ch.
string_magic’s operations: The
referenceThis document references all regular string_magic
operations. They can be used within string_magic or can be
accessed from string_ops or string_clean.
The operations are divided into four groups:
By default the function string_magic returns a plain
character vector. In this vignette it is sometimes nicer to apply the
function base::cat to display string_magic
results containing newlines. Ths function cat_magic does
exactly that and we will use it from time to time.
This section describes some of the most common string operations: extracting, replacing, collapsing, splitting, etc. Because they are so common, many of these operations have a one letter alias. These functions accept regex flags in their patterns. For more information on regex flags, see the dedicated section.
s,
S, split, Split: Split
stringsSplits the string according to a pattern. The four operations have
different defaults: ' ' for s and
split, and ',[ \t\n]*' for S and
Split (i.e. comma separation).
When character strings are split, their identity is kept in memory so that group-wise operations can be applied. See the section on group-wise operations.
# 'Split' with its default (comma separation)
string_magic("{Split ! romeo, juliet}")
#> [1] "romeo" "juliet"
# result with 's' is different
string_magic("{split ! romeo, juliet}")
#> [1] "romeo," "juliet"
# with argument: 's' and 'S' are identical
# note the flag 'fixed' (`f/`) to remove regex interpretation
string_magic("{'f/+'split, '-'collapse ! 5 + 2} = 3")
#> [1] "5 - 2 = 3"
# group wise operations (here `~(sort, collapse)`, see dedicated section)
prince_talk = c("O that this too too solid flesh would melt",
"Thaw, and resolve itself into a dew!",
"Or that the Everlasting had not fix'd",
"His canon 'gainst self-slaughter!")
cat_magic("Order matters:\n{split, ~(sort, collapse), align.center, lower, upper.sentence,
Q, '\n'collapse ? prince_talk}")
#> Order matters:
#> "O flesh melt solid that this too too would"
#> " Thaw, a and dew! Into itself resolve "
#> " Everlasting or fix'd had not that the "
#> " 'gainst his canon self-slaughter! "c,
C, collapse, Collapse: Collapse
stringsTo collapse (or concatenate) multiple strings into a single one. The
four operations are identical, only their defaults change. The default
is ' ' for c and collapse, and
', | and ' for C and Collapse.
The syntax of the argument is 's1' or 's1|s2'.
s1 is the string used to concatenate (think
paste(x, collapse = s1)). In arguments of the form
's1|s2', s2 will be used to concatenate the
last two elements.
# regular way
x = 1:4
string_magic("And {' and 'collapse ? x}!")
#> [1] "And 1 and 2 and 3 and 4!"
# with s2
string_magic("Choose: {', | or 'collapse ? 2:4}?")
#> [1] "Choose: 2, 3 or 4?"
# default of Collapse: enumeration (similar to operation enum)
wines = c("Saint-Estephe", "Margaux")
string_magic("I like {Collapse ? wines}.")
#> [1] "I like Saint-Estephe and Margaux."
# default of collapse: space concatenation
string_magic("{split, '.{5,}'get, collapse ! I don't like short words}")
#> [1] "don't short words"extract,
x, X: Extract patternsExtracts the first or multiple patterns from a string. Default
argument is '[[:alnum:]]+'. Command "extract"
accepts the option "first", and "x" and
"X" accept no option. x is an alias for
extract.first and X for extract.
Use the option "first" to extract only the first match for
each string.
When patterns are extracted, the identity of each original character string is kept in memory so that group-wise operations can be applied. See the section on group-wise operations.
x = c("margo: 32, 1m75", "luke doe: 27, 1m71")
string_magic("{'^\\w+'extract ? x} is {'\\d+'extract.first ? x}")
#> [1] "margo is 32" "luke is 27"
# illustrating multiple extractions
# group-wise operation (~()) is detailed in its own section
x = c("Combien de marins, combien de capitaines.",
"Qui sont partis joyeux pour des courses lointaines,",
"Dans ce morne horizon se sont évanouis !")
string_magic("Endings with i: {'i\\w*'extract, ~(', 'collapse), enum.1 ? x}.")
#> [1] "Endings with i: 1) ien, ins, ien, itaines, 2) i, is, intaines, and 3) izon, is."
x = c("6 feet under", "mahogany")
# single extraction
string_magic("{'\\w{3}'x ? x}")
#> [1] "fee" "mah"
# multiple extraction
string_magic("{'\\w{3}'X ? x}")
#> [1] "fee" "und" "mah" "oga"r,
R, replace: Replace patternsReplaces a pattern with a string. The three operators r,
R and replace are identical and have no
default. The syntax is 'flags/old' or
'old => new' with 'old' the pattern to find
and new the replacement. flags/ are optional
regex flags. The default for new is the empty string. On
top of regular regex flags, this operation also accepts the flags
"total" and single. total
instructs to replace the fulll string in case the pattern is found.
The flag "single" leads to only a single substitution
per string (the first pattern is replaced). That is, the function
base::sub is used instead of base::gsub.
# regex without replacement (ie removing)
string_magic("{'e'replace ! Where is the letter e?}")
#> [1] "Whr is th lttr ?"
# regex with replacement
string_magic("{'(?<!\\b)e => a'replace ! Where is the letter e?}")
#> [1] "Whara is tha lattar e?"
# with option "single"
string_magic("{'single/(?<!\\b)e => a'replace ! Where is the letter e?}")
#> [1] "Whare is the letter e?"
# we replace the full string with the flag total (`t/`)
x = c("Where is the letter e?", "Not this way!")
string_magic("{'total/e => here!'r ? x}")
#> [1] "here!" "Not this way!"clean:
Clean string patternsReplaces a pattern with a string. Similar to the operation
r, except that here the comma is a pattern separator. The
argument is of the form
"flags/pattern1, pattern2 => replacement". See detailed
explanations in string_clean().
get: Get
selected stringsRestricts the string vector to only the values respecting a pattern.
This operation has no default. Accepts the options "equal"
and "in". By default it uses the same syntax as string_get()
so that you can use regex flags and include logical operations between
regex patterns with ' & ' and ' | '. If
the option "equal" is used, a simple string equality with
the argument is tested (hence no flags are accepted). If the option
"in" is used, the argument is first split with respect to
commas and then set inclusion is tested.
x = row.names(mtcars)
# we only keep models containing "Merc" and ending with a letter ([[:alpha:]]$)
string_magic("Mercedes models: {'Merc & [[:alpha:]]$'get, '^.+ 'r, enum ? x}.")
#> [1] "Mercedes models: 240D, 280C, 450SE, 450SL and 450SLC."
models = c("Merc 230", "Merc 450SE", "Merc 480")
# we only ekep the ones in the set
string_magic("Mercedes models: {`models`get.in, enum ? x}.")
#> [1] "Mercedes models: Merc 230 and Merc 450SE."is:
Detect patterns in stringsDetects if a pattern is present in a string, returns a logical
vector. This operation has no default. Mostly useful as the final
operation in a string_ops()
call. By default it uses the same syntax as string_is()
so that you can use regex flags and include logical operations between
regex patterns with ' & ' and ' | '. If
the option "equal" is used, a simple string equality with
the argument is tested (hence no flags are accepted). If the option
"in" is used, the argument is first split with respect to
commas and then set inclusion is tested.
which:
Get the index of the strings containing a patternReturns the index of string containing a specified pattern. With no
default, can be applied to a logical vector directly. By default it uses
the same syntax as string_which()
so that you can use regex flags and include logical operations between
regex patterns with ' & ' and ' | '. If
the option "equal" is used, a simple string equality with
the argument is tested (hence no flags are accepted). If the option
"in" is used, the argument is first split with respect to
commas and then set inclusion is tested. Mostly useful as the final
operation in a string_ops()
call.
first:
Keep only the first elementsKeeps only the first n elements.
string_magic("First 3 mpg values: {3 first, enum ? mtcars$mpg}.")
#> [1] "First 3 mpg values: 21, 21 and 22.8."
# you could have done the same with regular R in the expression...
string_magic("First 3 mpg values: {enum ? head(mtcars$mpg, 3)}.")
#> [1] "First 3 mpg values: 21, 21 and 22.8."
# ...but not in the middle of an operations chain
string_magic("First 3 integer mpg values: {'f/!.'get, 3 first, enum ? mtcars$mpg}.")
#> [1] "First 3 integer mpg values: 21, 21 and 26."Negative numbers as argument remove the enum first n
values. You can add a second argument in the form
'n1|n2'first in which case the first n1 and
last n2 values are kept; n1 and
n2 must be positive numbers.
string_magic("Letters in the middle: {13 first, 5 last, enum ? letters}.")
#> [1] "Letters in the middle: i, j, k, l and m."
string_magic("First and last letters: {'3|3'first, enum ? letters}.")
#> [1] "First and last letters: a, b, c, x, y and z."
string_magic("Last letters: {-21 first, enum ? letters}.")
#> [1] "Last letters: v, w, x, y and z."K: Keep
only the first elements (alternative)Keeps only the first n elements; has more options than
first. The syntax is 'n'K,
'n|s'K, 'n||s'K. n provides the
number of elements to keep. If s is provided and the number
of elements are greater than n, then in 'n|s'
the string s is added at the end, and if
'n||s' the string s replaces the nth element.
The string s accepts specials values: + :n: or
:N: which gives the total number of items in digits or
letters (N) + :rest: or :REST: which gives the
number of elements that have been truncated in digits or letters
(REST)
last:
Keep only the last elementsKeeps only the last n elements. Negative numbers as
argument remove the last n values.
sort:
Sort the vectorSorts the vector in increasing order. Accepts an optional argument
and the option "num".
If an argument is provided, it must be a regex pattern that will be
applied to the vector using string_clean().
The sorting will be applied to the modified version of the vector and
the original vector will be ordered according to this sorting.
# first modifying the string before sorting
# here the regex first removes the first word, meaning that we sort on the last names
x = c("Jon Snow", "Khal Drogo")
string_magic("{'.+ 'sort, enum?x}")
#> [1] "Khal Drogo and Jon Snow"The option "num" sorts over a numeric version (with
silent conversion) of the vector and reorders the original vector
accordingly. Values which could not be converted are last.
x = "Mark is 34, Bianca is 55, Odette is 101, Julie is 21 and Frank is 5"
# sort on the "character string" number
string_magic("{', | and 'split, '\\D'sort, enum ? x}")
#> [1] "Odette is 101, Julie is 21, Mark is 34, Frank is 5 and Bianca is 55"
# we extract the numbers, then convert to numeric, then sort
string_magic("{', | and 'split, '\\D'sort.num, enum ? x}")
#> [1] "Frank is 5, Julie is 21, Mark is 34, Bianca is 55 and Odette is 101"Important note: the sorting operation is applied before any character conversion. If previous operations were applied, it is likely that numeric data were transformed to character.
dsort:
Sort the vector in decreasing orderSorts the vector in decreasing order. It accepts an optional argument
and the option "num". See the operation "sort"
for a description of the argument and the option.
rev:
Reverse the vectorReverses the vector.
unik:
Keep only unique elementsMakes the string vector unique.
table:
Attach unique elements to their frequenciesComputes the frequency of each element and attaches each element to
its frequency. Accepts an argument which must be a character string
representing a string_magic interpolation with the
following variables: x (the element), n (its
count) and s (its share). The default argument is
'{x} ({n ? n})'.
By default the resulting string vector is sorted by decreasing
frequency. You can change how the vector is sorted with five options:
sort (sorts on the elements), dsort
(decreasing sort), fsort (sorts on frequency),
dfsort (decreasing sort on freq. – default),
nosort (keeps the order of the first elements). Note that
you can combine several sorts (to resolve the ties of elements with same
frequencies).
dna = string_split("atagggagctacctgcgcgtcgcccaaaagcaggg", "")
cat_magic("Letters in the DNA seq. {''c, Q? dna}: ",
" - default: {table, enum ? dna}",
" - value sorted: {table.sort, enum ? dna}",
" - shares: {'{x} [{round(s * 100)}%]' table, enum ? dna}",
# `fsort` sorts by **increasing** frequency
" - freq. sorted: {'{q ? x}' table.fsort, enum ? dna}",
.sep = "\n")
#> Letters in the DNA seq. "atagggagctacctgcgcgtcgcccaaaagcaggg":
#> - default: g (12), c (10), a (9) and t (4)
#> - value sorted: a (9), c (10), g (12) and t (4)
#> - shares: g [34%], c [29%], a [26%] and t [11%]
#> - freq. sorted: 't', 'a', 'c' and 'g'each:
Repeat each elements of the vectorRepeats each element of the vector n times. Option
"c" then collapses the full vector with the empty string as
a separator.
times:
Repeats the vectorRepeats the vector sequence n times. Option
"c" then collapses the full vector with the empty string as
a separator.
rm:
Remove specific valuesRemoves elements from the vector. Options: "empty",
"blank", "noalpha", "noalnum",
"all". The optional argument represents the
pattern used to detect strings to be deleted.
By default it removes empty strings. Option "blank"
removes strings containing only blank characters (spaces, tab, newline).
Option "noalpha" removes strings not containing letters.
Option "noalnum" removes strings not containing alpha
numeric characters. Option "all" removes all strings
(useful in conditions, see the dedicated section). If an argument is
provided, only the options "empty" and "blank"
are available.
nuke:
Remove all valueRemoves all elements, equivalent to rm.all but possibly
more explicit. Useful in conditions, see the dedicated section.
insert:
Insert a character stringInserts a new element to the vector. Options: "right"
and "both". Option "right" adds the new
element to the right. Option "both" inserts the new element
on the two sides of the vector.
dp,
deparse: Deparse an objectIt deparses an R object and collapses it into a single string using newlines. By default it keeps only the first 50 lines of the deparsed object. The number of lines kept can be modified by using a numeric argument.
It accepts the options: short and vec. If
short, multiline deparsed elements are collapsed with
\\\\n and the number of characters cannot exceed the value
of the argument, which by default is 50.
If vec, then the deparsed element is not collapsed into
a single string, and only the first 50 (default) elements of the vector
are kept. You can increase/reduce the number of elements kept with the
argument.
fml = y ~ x1 + x2
# the full formula
string_magic("The estimated model is {dp ? fml}.")
#> [1] "The estimated model is y ~ x1 + x2."
# only the beginning of the formula
string_magic("The estimated model is {10 dp.short ? fml}.")
#> [1] "The estimated model is y ~ x1 +...."
# deparsing a long function, we keep only the first 5 lines:
cat_magic("The function lm:\n{5 dp ? lm}.")
#> The function lm:
#> function (formula, data, subset, weights, na.action, method = "qr",
#> model = TRUE, x = FALSE, y = FALSE, qr = TRUE, singular.ok = TRUE,
#> contrasts = NULL, offset, ...)
#> {
#> ret.x <- x.
# using vec to keep the deparsed vector, we add line numbers, then
# collapse it with newlines
cat_magic("The function lm:\n{'\n'c ! {1:5}: {5 dp.vec ? lm}}")
#> The function lm:
#> 1: function (formula, data, subset, weights, na.action, method = "qr",
#> 2: model = TRUE, x = FALSE, y = FALSE, qr = TRUE, singular.ok = TRUE,
#> 3: contrasts = NULL, offset, ...)
#> 4: {
#> 5: ret.x <- xlower:
Change the caseLower cases the full string.
upper:
Change the caseUpper cases the full string. Options: "first" and
"sentence". Option "first" upper cases only
the first character. Option "sentence" upper cases the
first letter after punctuation.
title:
Change the caseApplies a title case to the string. Options: "force" and
"ignore". Option "force" first puts everything
to lowercase before applying the title case. Option
"ignore" ignores a few small prepositions (“a”, “the”,
“of”, etc).
x = "bryan is in the KITCHEN"
# default: respects upper cases
string_magic("{title ? x}")
#> [1] "Bryan Is In The KITCHEN"
# force: force to title case
string_magic("{title.force ? x}")
#> [1] "Bryan Is In The Kitchen"
# ignore: ignores small prepositions
string_magic("{title.force.ignore ? x}")
#> [1] "Bryan Is in the Kitchen"ws:
Normalize white spacesNormalizes whitespaces (WS). It trims the whitespaces on the edges
and transforms any succession of whitespaces into a single one. Can also
be used to further clean the string with its options. Options:
"punct", "digit", "isolated".
Option "punct" cleans the punctuation. Option
"digit" cleans digits. Option "isolated"
cleans isolated letters. WS normalization always come after any of these
options. Important note: punctuation (or digits) are
replaced with WS and not the empty string. This means
that string_magic("ws.punct ! Meg's car") will become
"Meg s car".
x = " I should? review 85 4 this text!!"
cat_magic("v0: {x}",
"v1: {ws ? x}",
"v2: {ws.punct ? x}",
"v3: {ws.punct.digit ? x}",
"v4: {ws.punct.digit.isolated ? x}", .sep = "\n")
#> v0: I should? review 85 4 this text!!
#> v1: I should? review 85 4 this text!!
#> v2: I should review 85 4 this text
#> v3: I should review this text
#> v4: should review this texttws:
Trim white spacesTrims the white spaces on both ends of the strings.
q,
Q, bq: Add various type of quotesTo add quotes to the strings. q: single quotes, Q: double quotes, bq: back quotes.
format,
Format: Format the values with
base::formatApplies the base R’s function base::format() to the
string. By default, the values are left aligned, even numbers
(differently from base::format()’s behavior). The upper
case command (Format) applies right alignment. Options:
"0", "left", "zero",
"right", "center". Options "0" or
"zero" fills the blanks with 0s: useful to format numbers.
Option "right" right aligns, and "center"
centers the strings.
%: Apply
sprintf formattingApplies base::sprintf() formatting. The syntax is
'arg'% with arg an sprintf formatting, or directly the
sprint formatting.
stopwords: Remove stop wordsRemoves basic English stopwords (the snowball list is used). The
stopwords are replaced with an empty space but the left and right WS are
untouched. So WS normalization may be needed (see operation
ws).
ascii:
Turn the string to ASCIITurns all letters into ASCII with transliteration. Failed
translations are transformed into question marks. Options:
"silent", "utf8". By default, if some
conversion fails a warning is prompted. Option "silent"
disables the warning in case of failed conversion. The conversion is
done with base::iconv(), option "utf8"
indicates that the source endocing is UTF-8, can be useful in some
cases.
round,
signif, r0-r6,
s0-s6: Formatting numbersFormats numbers by rounding at a given level or displaying a certain number of significant digits.
Arguments: - 'suffix': adds a suffix -
'prefix|suffix': adds a prefix and a suffix, the two are
separated with a pipe.
Options: - 0-9: the number of digits to
round at (round) or the number of significant digits
(signif) - int: whether to preserve integers
from formattting. By default decimals are appended to integers (unless
rounding at 0 digits is requested) - nocomma: whether to
drop the comma separating the thousands -
s0-s9 (options for round):
additionnaly the number of significant digits to preserve -
r0-r9 (options for signif):
additionnaly the number of digits to round at
Algorithm: signif displays d significant
digits (default is 1). If the dth significant
digit is not a decimal, the digits up to the first decimal are
displayed. Example if d = 2, 153.12 will be
displayed as 153.1; 0.0153 will be displayed
as 0.015; 153 as 153.0.
round displays up to the dth decimal
(default is 0). Example if d = 2:
153.154 will be displayed as 153.15;
153 as 153.00.
When signif and round are combined, round
provides the minimum number of decimals displayed.
Note that non-numeric vectors are converted to numeric beforehand,
non-numeric values that could not be converted are preserved. To have
more control on the conversion, you can apply the num operation beforehand.
# rounding at 2 digits
cat_magic("pi = {r2 ? pi}\n",
# same as above with a different syntax
"pi = {round.2 ? pi}")
#> pi = 3.14
#> pi = 3.14
x = c(153, 207.256, 0.00254, 15231312.2)
# keeping one significant digit
cat_magic("v1: {s1, align ? x} ",
# removing the comma for large numbers and preserving ints
"v2: {s1.int.nocomma ? x}", .collapse = "\n")
#> v1: 153.0 v2: 153
#> v1: 207.2 v2: 207.2
#> v1: 0.002 v2: 0.002
#> v1: 15,231,312.2 v2: 15231312.2
# combining signif with round
y = c(pi, 0.00125)
cat_magic("raw: {align ? y} ",
"s1: {s1, align ? y} ",
"r2: {r2, align ? y} ",
"s1.r2: {s1.r2 ? y}", .collapse = "\n")
#> raw: 3.14159265358979 s1: 3.1 r2: 3.14 s1.r2: 3.14
#> raw: 0.00125 s1: 0.001 r2: 0.00 s1.r2: 0.001
# prefix and prefix: use and argument
z = c(55, 22.5, 21)
cat_magic("Costs in euros : {' €'r1, enum ? z}.",
"\nCosts in dollars: {'USD |'r1, enum ? z}.")
#> Costs in euros : 55.0 €, 22.5 € and 21.0 €.
#> Costs in dollars: USD 55.0, USD 22.5 and USD 21.0.
# non numeric values are preserved
xraw = c("55", "five")
string_magic("Valuess {r1, enum ? xraw}.")
#> [1] "Valuess 55.0 and five."
# use the `num` command for more control
string_magic("Values: {num.rm, r1, enum ? xraw}.")
#> [1] "Values: 55.0."n,
N: Formatting integersFormats integers by adding a comma to separate thousands.
Options: - "letter": writes the number in letters (large
numbers keep their numeric format) - "upper": like the
option "letter" but uppercases the first letter -
"0", "zero": left pads numeric vectors with 0s
- "roman", "Roman": write the integer in Roman
with utils::as.roman. The lower case version writes them in
lower case
Variants: - the upper case command N adds the option
"letter" (i.e. is equiv. to n.letter)
x = c(5, 12, 52123)
string_magic("She owes {n, '$'paste, enum ? x}.")
#> [1] "She owes $5, $12 and $52,123."
# option 0: all same width, no ',' for thousands
cat_magic("|---|\n{n.0, '\n'collapse ? x}")
#> |---|
#> 00005
#> 00012
#> 52123
# option "upper"
n = 5
string_magic("{n.upper ? n} is my favourite number.")
#> [1] "Five is my favourite number."
# N: like "n.letter"
x = 5
string_magic("He's {N ? x} years old.")
#> [1] "He's five years old."
# roman
string_magic("What's nicer? {collapse?11:13}, {n.roman, c?11:13} or {n.Roman, c?11:13}?")
#> [1] "What's nicer? 11 12 13, xi xii xiii or XI XII XIII?"nth,
Nth: Numbered positionWhen applied to a number, this operator writes them as a rank.
Options: "letter", "upper",
"compact".
Option "letter" tries to write the numbers in letters,
but note that it stops at 20. Option "upper" is the same as
"letter" but uppercases the first letter. Option
"compact" aggregates consecutive sequences in the form
"start_n_th to end_n_th".
The upper case command (Nth) adds the option
"letter".
ntimes,
Ntimes: Number of timesWrite numbers in the form n times. Options:
"letter", "upper". Option
"letter" writes the number in letters (up to 100). Option
"upper" does the same as "letter" and
uppercases the first letter.
string_magic("They lost {enum ! {ntimes ? c(1, 12)} against {S!Real, Barcelona}}.")
#> [1] "They lost once against Real and 12 times against Barcelona."The upper case command (Ntimes) adds the option
"letter".
firstchar, lastchar: Keep only the first, last
charactersTo select the first/last characters of each element. Negative numbers remove the first/last characters.
k,
shorten, Shorten: Shortens character
stringsTo keep only the first n characters (like
firstchar but with more options). (Note that k
stands for “keep” and exists for historical reasons.) Available options:
"include", "dots". The argument can be of the
form 'n' or 'n|s' with n a number
and s a string. n provides the number of
characters to keep. Optionnaly, only for strings whose length is
greater than n, after truncation, the string
s is appended at the end.
By default, if argument s is provided, strings longer
than n end up at size n + nchar(s). If option
"include" is provided, the strings are guaranteed to be of
maximum size n, even after the string s has
been appended. Example: if n=4 and s="..",
then “hello” becomes “hell..” without "include", and “he..”
with it.
Option "dots": if strings are longer than
n+1, they are truncated at n-1 and two dots
are appended. For example if n = 3, then “hello” becomes
“he..”. Disregards the argument s. The operation
"Shorten" (upper case), is with the option
"dots".
Note that another way to add the option "include" is to
use a double pipe for the argument s, like in
'n||s'.
fill,
align, width: Fill character stringsFills the character strings up to a size in order to fit a given
width. align and width are aliases to
fill. Options: "right" or
"center". Default is left-alignment of the strings.
The argument is optional and can be of the form 'n' or
'n|s'. By default if no argument is provided, of if
n=0,n is equal to the maximum character length
of the vector. The optional argument s is a symbol used to
fill the blanks. By default s is equal to a white
space.
Option "right" right aligns and "center"
centers the strings.
See help for string_fill()
for more information.
life = "full of sound and fury, Signifying nothing"
cat_magic("{'[ ,]+'split, upper.first, fill.center, q, '\n'collapse ? life}")
#> ' Full '
#> ' Of '
#> ' Sound '
#> ' And '
#> ' Fury '
#> 'Signifying'
#> ' Nothing '
# fixing the length and filling with 0s
string_magic("{'5|0'fill.right, enum ? c(1, 55)}")
#> [1] "00001 and 00055"paste,
append: Append textPastes a custom character string to all elements of the string. The
operations paste and append are equivalent.
This operation has no default. Options: "left",
"both", "right", "front",
"back", "delete". By default, a string is
pasted on the left. Option "right" pastes on the right and
"both" pastes on both sides. Option "front"
only pastes on the first element while option "back" only
pastes on the last element. Option "delete" first replaces
all elements with the empty string.
The argument can be of the form s1 or
s1|s2. If of the second form, this is equivalent to
chaining two paste operations, once on the left and once on
the right: 's1'paste, 's2'paste.right.
join:
Join linesJoins lines ending with a double backslash.
escape:
Escape special charactersAdds backslashes in front of specific characters. Options
"nl", "tab". Option "nl" escapes
the newlines (\n), leading them to be displayed as
"\\\\n". Option "tab" does the same for tabs
("\t"). This is useful to make the value free of space
formatters. The default behavior is to escape both newlines and
tabs.
num:
Convert to numericConverts to numeric. Options: "warn",
"soft", "rm", "clear". By
default, the conversion is performed silently and elements that fail to
convert are turned into NA. Option "warn" displays a
warning if the conversion to numeric fails. Option "soft"
does not convert if the conversion of at least one element fails,
leading to a character vector. Option "rm" converts and
removes the elements that could not be converted. Option
"clear" turns failed conversions into the empty string, and
hence lead to a character vector.
x = c(5, "six")
cat_magic(" origin: {enum, q ? x}",
" num: {num, enum, q ? x}",
" num.rm: {num.rm, enum, q ? x}",
" num.soft: {num.soft, enum, q ? x}",
"num.clear: {num.clear, enum, q ? x}", .sep = "\n")
#> origin: '5 and six'
#> num: '5 and NA'
#> num.rm: '5'
#> num.soft: '5 and six'
#> num.clear: '5 and 'enum:
Create an enumerationEnumerates the elements. It creates a single string containing the comma separated list of elements. If there are more than 7 elements, only the first 6 are shown and the number of items left is written.
You can add the following options:
q, Q, or bq: to quote the
elementsor, nor: to finish with an ‘or’ (or ‘nor’)
instead of an ‘and’comma: to finish the enumeration with “,” instead of “,
and”.i, I, a, A,
1: to enumerate with this prefix, like in: i) one, and ii)
twox = c("Marv", "Nancy")
string_magic("The murderer must be {enum.or ? x}.")
#> [1] "The murderer must be Marv or Nancy."
x = c("oranges", "milk", "rice")
string_magic("Shopping list: {enum.i.q ? x}.")
#> [1] "Shopping list: i) 'oranges', ii) 'milk', and iii) 'rice'."
# enum is made for display: when vectors are too long, they are truncated
# default is at 7
x = string_magic("x{sample(100, 30)}")
string_magic("The problematic variables are {'x'sort.num, enum ? x}.")
#> [1] "The problematic variables are x2, x3, x9, x10, x12, x15 and 24 others."
# you can augment or reduce the numbers to display with an option
string_magic("The problematic variables are {'x'sort.num, enum.3 ? x}.")
#> [1] "The problematic variables are x2, x3 and 28 others."len,
Len: Formatted lengthGives the length of the vector. Options "letter",
"upper", "num". Option "letter"
writes the length in words (up to 100). Option "upper" is
the same as letter but uppercases the first letter. By default, the
number is formatted: commas are inserted to separate thousands.
cat_magic("The length of 1:5000:",
" - len = {len ? 1:5000}",
" - len.num = {len.num ? 1:5000}", .sep = " \n")
#> The length of 1:5000:
#> - len = 5,000
#> - len.num = 5000The upper case command (Len) adds the option
"letter" (only for small numbers).
swidth:
Add newlines to force the string to fit a given widthThie operation stands for “screen width”. It formats the string to
fit a given width by cutting at word boundaries and adding newlines
appropriately. Accepts arguments of the form 'n' or
'n|s', with n a number and s a
string. An argument of the form 'n|s' will add
s at the beginning of each line. Further, by default a
trailing white space is added to s; to remove this
behavior, add an underscore at the end of it. The argument
n is either an integer giving the target character width
(minimum is 15), or it can be a fraction expressing the target size as a
fraction of the current screen. Finally it can be an expression that
uses the variable .sw which will capture the value of the
current screen width.
x = "this is a long sentence"
cat_magic("------ version 0 ------\n{x}",
"------ version 1 ------\n{15 swidth ? x}",
"------ version 2 ------\n{'15|#>'swidth ? x}",
"------ version 3 ------\n{'15|#>_'swidth ? x}", .sep = "\n")
#> ------ version 0 ------
#> this is a long sentence
#> ------ version 1 ------
#> this is a long
#> sentence
#> ------ version 2 ------
#> #> this is a
#> #> long
#> #> sentence
#> ------ version 3 ------
#> #>this is a
#> #>long sentenceThese binaries (installable software) and packages are in development.
They may not be fully stable and should be used with caution. We make no claims about them.