| Type: | Package |
| Title: | Genome-Wide Nucleic Acid Melting Temperature Profiling and Multi-Omics Integration |
| Version: | 1.1.2 |
| Date: | 2026-10-05 |
| Description: | Accurate calculation of nucleic acid melting temperature (Tm) is fundamental to many molecular biology applications, and this software scales Tm analysis from individual sequences to genome-wide thermodynamic profiling. This package extends Tm analysis from simple sequence level computation to comprehensive genome-wide thermodynamic profiling. It takes four input sources: sequence strings, a FASTA file, an installed 'BSgenome' package named by string, or a 'GRanges' carrying sequences. A 'regions' argument selects what to cover and 'window' and 'slide' set the resolution at which it is tiled. The implementation provides three Tm calculation methods: the Wallace rule (Thein & Wallace, 1986), empirical GC-content formulas (Marmur, 1962; Schildkraut, 1965; Wetmur, 1991; Untergasser, 2012; von Ahsen, 2001), and nearest-neighbor thermodynamics (Breslauer, 1986; Sugimoto, 1996; Allawi, 1997, 1998; SantaLucia, 2004; Freier, 1986; Xia, 1998; Chen, 2012; Bommarito, 2000; Turner, 2010; Sugimoto, 1995; Peyret, 1999; SantaLucia & Peyret, 2001; Watkins & SantaLucia, 2005; Zuber, 2022; Ghosh, 2020, 2023). Nearest-neighbor parameter sets are provided for DNA, RNA and RNA/DNA hybrid duplexes. These include sets obtained by melting-temperature optimization that are fitted directly at a stated sodium concentration (Weber, 2015; Ferreira, 2019; Basilio Barbosa, 2019; Banerjee, 2020), which replace salt correction rather than being corrected; salt correction is skipped automatically when the requested condition matches the one a set was fitted at. The Zuber (2022) set additionally replaces the single terminal-AU penalty with end terms that depend on the penultimate base pair, applied automatically at both duplex ends. Parameter sets measured under molecular crowding (Ghosh, 2020, 2023) are also provided for DNA and RNA duplexes, so that duplex stability can be evaluated under cell-like rather than dilute-solution conditions. Salt corrections are otherwise applied to the nearest-neighbor model (SantaLucia, 1996, 1998; Owczarzy, 2004, 2008), while each empirical GC-content formula carries the salt term it was published with; corrections for chemical conditions such as dimethyl sulfoxide and formamide apply to both. A compiled C++ core, and task partitioning by region across 'BiocParallel' workers through a 'BPPARAM' argument, profile the human genome in 3 minutes on a six-core laptop. This package returns result as a GRanges object for interoperability with Bioconductor workflows and downstream multi-omics analyses. Data-level integration reconciles Tm windows with external multi-omics GRanges objects through overlap, nearest-feature, windowed-count, and binned-average strategies, returning a single unified GRanges object ready for downstream analysis. Visualization-level integration renders multiple feature layers as independent concentric tracks on a shared genomic axis, each retaining its native coordinate resolution. Group comparison supports Wilcoxon rank-sum and Student's t-tests with multiple available correction methods for contrasting Tm and other features across region classes. |
| BugReports: | https://github.com/JunhuiLi1017/TmCalculator/issues |
| License: | MIT + file LICENSE |
| Depends: | R (≥ 3.5) |
| VignetteBuilder: | knitr |
| Imports: | BiocGenerics, Biostrings, GenomeInfoDb, GenomicRanges, BiocParallel, IRanges, Rcpp, S4Vectors, graphics, grDevices, methods |
| LinkingTo: | Rcpp |
| Suggests: | BSgenome, testthat (≥ 3.0.0), knitr, rmarkdown, remotes, BiocManager, BSgenomeForge, karyoploteR, ggplot2, ggridges, ggforce, ps |
| NeedsCompilation: | yes |
| Repository: | CRAN |
| RoxygenNote: | 7.3.2 |
| LazyData: | true |
| LazyDataCompression: | xz |
| Encoding: | UTF-8 |
| Packaged: | 2026-10-05 15:03:11 UTC; lij11 |
| Author: | Junhui Li |
| Maintainer: | Junhui Li <ljh.biostat@gmail.com> |
| Date/Publication: | 2026-10-05 16:30:41 UTC |
TmCalculator: Genome-Wide Nucleic Acid Melting Temperature Profiling and Multi-Omics Integration
Description
Accurate calculation of nucleic acid melting temperature (Tm) is fundamental to many molecular biology applications, and this software scales Tm analysis from individual sequences to genome-wide thermodynamic profiling. This package extends Tm analysis from simple sequence level computation to comprehensive genome-wide thermodynamic profiling. It takes four input sources: sequence strings, a FASTA file, an installed 'BSgenome' package named by string, or a 'GRanges' carrying sequences. A 'regions' argument selects what to cover and 'window' and 'slide' set the resolution at which it is tiled. The implementation provides three Tm calculation methods: the Wallace rule (Thein & Wallace, 1986), empirical GC-content formulas (Marmur, 1962; Schildkraut, 1965; Wetmur, 1991; Untergasser, 2012; von Ahsen, 2001), and nearest-neighbor thermodynamics (Breslauer, 1986; Sugimoto, 1996; Allawi, 1997, 1998; SantaLucia, 2004; Freier, 1986; Xia, 1998; Chen, 2012; Bommarito, 2000; Turner, 2010; Sugimoto, 1995; Peyret, 1999; SantaLucia & Peyret, 2001; Watkins & SantaLucia, 2005; Zuber, 2022; Ghosh, 2020, 2023). Nearest-neighbor parameter sets are provided for DNA, RNA and RNA/DNA hybrid duplexes. These include sets obtained by melting-temperature optimization that are fitted directly at a stated sodium concentration (Weber, 2015; Ferreira, 2019; Basilio Barbosa, 2019; Banerjee, 2020), which replace salt correction rather than being corrected; salt correction is skipped automatically when the requested condition matches the one a set was fitted at. The Zuber (2022) set additionally replaces the single terminal-AU penalty with end terms that depend on the penultimate base pair, applied automatically at both duplex ends. Parameter sets measured under molecular crowding (Ghosh, 2020, 2023) are also provided for DNA and RNA duplexes, so that duplex stability can be evaluated under cell-like rather than dilute-solution conditions. Salt corrections are otherwise applied to the nearest-neighbor model (SantaLucia, 1996, 1998; Owczarzy, 2004, 2008), while each empirical GC-content formula carries the salt term it was published with; corrections for chemical conditions such as dimethyl sulfoxide and formamide apply to both. A compiled C++ core, and task partitioning by region across 'BiocParallel' workers through a 'BPPARAM' argument, profile the human genome in 3 minutes on a six-core laptop. This package returns result as a GRanges object for interoperability with Bioconductor workflows and downstream multi-omics analyses. Data-level integration reconciles Tm windows with external multi-omics GRanges objects through overlap, nearest-feature, windowed-count, and binned-average strategies, returning a single unified GRanges object ready for downstream analysis. Visualization-level integration renders multiple feature layers as independent concentric tracks on a shared genomic axis, each retaining its native coordinate resolution. Group comparison supports Wilcoxon rank-sum and Student's t-tests with multiple available correction methods for contrasting Tm and other features across region classes.
Author(s)
Maintainer: Junhui Li ljh.biostat@gmail.com (ORCID)
Authors:
Lihua Julie Zhu julie.zhu@umassmed.edu (ORCID)
See Also
Useful links:
Report bugs at https://github.com/JunhuiLi1017/TmCalculator/issues
Lazy $df accessor for TmCalculator objects
Description
result$df is computed on demand from result$gr instead of
being stored eagerly, so genome-scale results are not converted to a
data.frame unless actually requested. All other elements behave as plain
list access.
Usage
## S3 method for class 'TmCalculator'
x$name
Arguments
x |
A |
name |
Element name. |
Value
The element, or a data.frame built from x$gr when
name == "df" and no stored df exists.
Vectorized chemical correction over per-sequence GC percent
Description
Mirrors chem_correct() exactly (including argument validation) but
accepts a vector of GC percentages, returning one correction per sequence.
Used by the Rcpp-backed tm_nn path.
Usage
.chem_correct_vec(
DMSO = 0,
formamide_unit = list(value = 0, unit = "percent"),
dmso_factor = 0.75,
formamide_factor = 0.65,
pt_gc = NULL
)
Record lengths of a FASTA file, without reading the sequences
Description
Record lengths of a FASTA file, without reading the sequences
Usage
.fasta_lengths(path)
Arguments
path |
Path to a FASTA file, optionally gzipped. |
Value
A named numeric vector of record lengths.
Filter windows with too many N bases
Description
Reads each window sequence and drops those where the N fraction exceeds max_N_frac. Uses batched getSeq for efficiency.
Usage
.filter_N_windows(bsgenome, chr, win_starts, win_ends, max_N_frac, window)
Detect the first and last non-N positions on a chromosome
Description
Uses a coarse block scan to find the positions of the first and last non-N base on a chromosome. Efficient because it only reads N_scan_block bp at a time from each end.
Usage
.find_N_bounds(bsgenome, chr, chr_start, chr_end, block_size)
Vectorized GC percent over a character vector of sequences
Description
Mirrors gc_content() exactly, including its ambiguity apportioning and its
GC/(A+C+G+T) denominator, but counts every base in a single compiled
pass per sequence (cpp_base_counts()) instead of splitting each
sequence into a character vector with s2c() and scanning it five
times. The apportioning arithmetic stays here, vectorised over the count
matrix, so the published formula remains the readable one.
Usage
.gc_vec(input_seq, ambiguous = FALSE)
Arguments
input_seq |
Character vector of sequences. |
ambiguous |
Logical; apportion ambiguous IUPAC codes as |
Value
Numeric vector of GC percentages, NA where a sequence is
NA or contains no countable base.
Load the BSgenome object from an installed BSgenome.* data package
Description
The genome object name is given by the BSgenomeObjname field in
DESCRIPTION (e.g. Hsapiens), not necessarily the package name.
Usage
.get_bsgenome_from_pkg(pkg)
Arguments
pkg |
Character scalar: installed BSgenome package name. |
Value
A BSgenome object.
Sequence extraction by preloading whole chromosomes
Description
Sequence extraction by preloading whole chromosomes
Usage
.getseq_preload_chr(gr_query, genome_objs, parsed)
Arguments
gr_query |
Query |
genome_objs |
Named list of BSgenome objects. |
parsed |
Parsed coordinate data frame. |
Value
DNAStringSet of extracted sequences.
Vectorized sequence extraction with getSeq
Description
Vectorized sequence extraction with getSeq
Usage
.getseq_vectorized(gr_query, genome_objs, parsed)
Arguments
gr_query |
Query |
genome_objs |
Named list of BSgenome objects. |
parsed |
Parsed coordinate data frame. |
Value
DNAStringSet of extracted sequences.
Load installed BSgenome packages
Description
Load installed BSgenome packages
Usage
.load_genome_packages(pkg_names)
Arguments
pkg_names |
Character vector of BSgenome package names. |
Value
Named list of genome objects.
Normalize Tm/GC metadata column names on a GRanges object
Description
Renames legacy lowercase tm/gc columns to Tm/GC.
Usage
.normalize_tm_gc_metadata(gr)
Parse coordinate strings into a data frame
Description
Parse coordinate strings into a data frame
Usage
.parse_coord_strings(coord_vec, pkg_name_override = NULL)
Arguments
coord_vec |
Character vector of colon-separated coordinate strings. |
pkg_name_override |
Optional BSgenome package name for 4-field strings. |
Value
Data frame with columns chr, win_start, win_end,
strand, pkg_name, and region_id.
Vectorized salt correction over per-sequence GC percent and length
Description
Mirrors salt_correct() exactly, but takes precomputed per-sequence
GC percent (gc_content() semantics: GC/(A+C+G+T)) and sequence lengths instead of
sequences, so one call covers a whole chunk. Used by the Rcpp-backed
tm_nn path.
Usage
.salt_correct_vec(Na, K, Tris, Mg, dNTPs, method, gc_pct, seq_len)
Stage sequences as a FASTA file so that workers read rather than receive them
Description
Written in blocks: an XStringSet over the whole vector would double peak
memory at exactly the input size where this path is worth using. The
record name carries the input position, so a sequence dropped later for
containing N can still be identified.
Usage
.spill_fasta(seqs, tmpdir = tempdir())
Arguments
seqs |
Character vector of sequences. |
tmpdir |
Directory for the file. |
Value
The path, carrying the input count and names as attributes.
Read 'regions' as an interval query against a GRanges source
Description
"chr1" means the whole of that seqname and
"chr1:1000-2000" means that interval of it. A vector of bare
integers is positional instead, the nth ranges, which is what the same
input means for a FASTA file or for sequences; NULL is returned in
that case so the caller resolves it by position.
Usage
.tm_as_granges(regions, src)
Arguments
regions |
Character or numeric regions. |
src |
A GRanges source from |
Value
A GRanges to overlap against, or NULL for positional.
Fill in a GRanges that carries sequences but not their complements
Description
Every other input form reaches to_genomic_ranges, which
derives the complement. A GRanges handed straight to
tm_calculate skipped that step, so an object built with a
sequence column and nothing else (which is exactly what
regions treats as a source) reached the compiled core with some
sequences and no complements and failed there, on a message about
cseqs that says nothing about what the caller did.
Usage
.tm_complete_gr(gr)
Arguments
gr |
A |
Details
The complement is the plain base-for-base one, not the reverse
complement: tm_nn() reads the two strands in register, so
reversing one would pair every position with the wrong partner.
Value
The same object, with a complement column.
Compute Tm for one task's windows
Description
Compute Tm for one task's windows
Usage
.tm_finish(gr, keep_sequence, model)
Arguments
gr |
Windows with sequences. |
keep_sequence |
Keep the sequence columns. |
model |
Model arguments for |
Value
A GRanges.
Resolve one identifier against a source's own names
Description
Names first, then position. On a BSgenome the chr prefix is added
or removed as the genome requires, since that is a naming convention
rather than information; FASTA records and seqnames are matched
exactly, because theirs are arbitrary and guessing could match the wrong
one.
Usage
.tm_match(x, available, src)
Arguments
x |
Identifiers to resolve. |
available |
The source's names, possibly empty strings. |
src |
The source, used for its kind and for error messages. |
Value
Integer positions into available.
Apply the selected model to windows that already carry their sequence
Description
The method dispatch that used to be the whole of tm_calculate().
It is separate now because both routes through the function end here: the
direct one, and every task of the profiling one.
Usage
.tm_model(gr, model)
Arguments
gr |
Windows with |
model |
Model arguments, as assembled by |
Value
A TmCalculator object.
Where a source's records sit in the coordinate system the caller cares about
Description
Staging a GRanges to a FASTA turns each range into a record that
starts at 1, so without this the profile of a range at chr1:1001-1060
would come back as chr1:1-60. Every other source already numbers from the
coordinate the caller asked about, so its offset is zero.
Usage
.tm_offsets(idx, src)
Arguments
idx |
Row indices into the source. |
src |
A source from |
Value
A numeric vector of offsets to add to record-relative positions.
Resolve 'regions' against a source
Description
Accepts names, numbers, "name:start-end" strings, a mixture, or a
GRanges. Returns one row per requested region, in source order.
An unresolvable name or an out-of-bounds coordinate is an error rather
than a silent drop: quietly skipping a region would return a profile that
is short by that region with nothing to say so.
Usage
.tm_regions(regions, src)
Arguments
regions |
The user's |
src |
A source from |
Value
A data frame with idx, name, start,
end, whole.
Run the tasks and reassemble one profile
Description
Each task opens the source itself, so what crosses between processes is a name and a coordinate pair rather than any sequence. That is what makes parallelism pay here, and why an in-memory source is staged to a file first rather than sent over a socket.
Usage
.tm_run(tasks, src, window, slide, model, BPPARAM, keep_sequence, verbose)
Arguments
tasks |
From |
src |
A source from |
window, slide |
Tiling; |
model |
Model arguments to hand to |
BPPARAM |
A |
keep_sequence |
Keep the sequence columns in the result. |
verbose |
Report task and window counts. |
Value
A GRanges in source order.
Classify the input and describe what it offers
Description
Classify the input and describe what it offers
Usage
.tm_source(x, complement_seq = NULL)
Arguments
x |
The user's |
complement_seq |
Passed through to |
Value
A list with kind, the reference needed to reopen the source
(pkg, path or gr), and lens, the length of
every chromosome, record or range it contains.
One task against a BSgenome
Description
One task against a BSgenome
Usage
.tm_task_bsgenome(task, src, window, slide, keep_sequence, model)
Arguments
task |
A task from |
src |
BSgenome package name. |
window, slide, keep_sequence, model |
As in |
Value
A GRanges.
One task against a FASTA file
Description
Reads only its own records, with skip and nrec, so the
sequence never travels between processes.
Usage
.tm_task_fasta(task, src, window, slide, keep_sequence, model)
Arguments
task |
A task from |
src |
BSgenome package name. |
window, slide, keep_sequence, model |
As in |
Value
A GRanges.
Cut the requested regions into tasks
Description
One task is what a single worker owns from start to finish. Long regions
are split into segment_size pieces; short whole records are merged,
because reading record n of a file means skipping the first n - 1, so a
task per record would rescan the file once per record.
Usage
.tm_tasks(req, src, unit, segment_size, step)
Arguments
req |
Regions from |
src |
A source from |
unit, segment_size, step |
Task granularity. |
Value
A list of tasks.
Filter invalid bases in nucleotide sequences
Description
This function processes nucleotide sequences by converting characters to uppercase and replacing invalid bases with "". based on the specified method. The function preserves the sequence length and attributes (name and Tm) of each sequence.
Usage
check_filter_seq(seq_list, method)
Arguments
seq_list |
Input sequence in 5' to 3' direction. Must be provided as: - A list of sequences with attributes (name and Tm) |
method |
Method to determine valid bases: TM_Wallace: Valid bases are "A","B","C","D","G","H","I","K","M","N","R","S","T","V","W" and "Y" TM_GC: Valid bases are "A","B","C","D","G","H","I","K","M","N","R","S","T","V","W", "X" and "Y" TM_NN: Valid bases are "A","C","G","I" and "T" |
Value
Returns a list of sequences with the same structure as input, where invalid bases are replaced with ""
Author(s)
Junhui Li
References
citation("TmCalculator")
Corrections of melting temperature with chemical substances
Description
Apply corrections to melting temperature calculations based on the presence of DMSO and formamide. These corrections are rough approximations and should be used with caution.
Usage
chem_correct(
DMSO = 0,
formamide_unit = list(value = 0, unit = "percent"),
dmso_factor = 0.75,
formamide_factor = 0.65,
pt_gc = NULL
)
Arguments
DMSO |
Percent DMSO concentration in the reaction mixture. Default: 0 DMSO can lower the melting temperature of nucleic acid duplexes. |
formamide_unit |
A list containing formamide concentration information: - value: numeric value of formamide concentration - unit: character string specifying the unit ("percent" or "molar") Default: list(value=0, unit="percent") |
dmso_factor |
Coefficient of melting temperature (Tm) decrease per percent DMSO. Default: 0.75 (von Ahsen N, 2001, PMID:11673362) Other accepted empirical coefficients: 0.5, 0.6, 0.65, 0.675 |
formamide_factor |
Coefficient of melting temperature (Tm) decrease per percent formamide. Default: 0.65 (empirical convention); accepted alternatives: 0.6, 0.72. Hutton (1977) reports 0.60, not the default 0.65. |
pt_gc |
Percentage of GC content in the sequence (0-100 This is used in molar formamide corrections. |
Details
When formamide_unit$unit = "percent": Correction = - factor * percentage_of_formamide
When formamide_unit$unit = "molar": Correction = (0.453 * GC/100 - 2.88) * formamide, from Blake & Delcourt (1996).
Author(s)
Junhui Li
References
von Ahsen N, Wittwer CT, Schutz E. Oligonucleotide melting temperatures under PCR conditions: nearest-neighbor corrections for Mg2+, deoxynucleotide triphosphate, and dimethyl sulfoxide concentrations with comparison to alternative empirical formulas. Clin Chem 2001, 47:1956-1961.
Blake RD, Delcourt SG (1996). Thermodynamic effects of formamide on DNA stability. NAR 24:2095-2103. <doi:10.1093/nar/24.11.2095>
Hutton JR (1977). Renaturation kinetics and thermal stability of DNA in aqueous solutions of formamide and urea. <doi:10.1093/nar/4.10.3537>
Examples
# DMSO correction
chem_correct(DMSO = 3)
# Formamide correction (percent)
chem_correct(formamide_unit = list(value = 1.25, unit = "percent"), pt_gc = 50)
# Formamide correction (molar)
chem_correct(formamide_unit = list(value = 1.25, unit = "molar"), pt_gc = 50)
Compare numeric GRanges metadata across groups
Description
Test whether one or more numeric metadata columns (e.g. Tm, GC)
differ between levels of a categorical grouping column in a GRanges
object.
Usage
compare_groups(
gr,
target = "Tm",
method = c("wilcoxon", "t.test"),
group,
min_n_per_group = 2L,
paired = FALSE,
alternative = c("two.sided", "less", "greater"),
posthoc = TRUE,
p.adjust.method = c("holm", "hochberg", "hommel", "bonferroni", "BH", "BY", "fdr",
"none")
)
Arguments
gr |
A |
target |
Character vector of metadata column names to test (e.g.
|
method |
Statistical test family. One of:
|
group |
Character. Name of a metadata column in |
min_n_per_group |
Minimum number of non-missing observations required
per group. Default: |
paired |
Logical. Only for exactly two groups. Default: |
alternative |
Character. Alternative hypothesis for two-group tests.
One of |
posthoc |
Logical. For |
p.adjust.method |
Multiple-testing correction for post-hoc pairwise
comparisons. Passed to |
Details
The test used depends on method and the number of group levels:
| Groups | method = "wilcoxon" | method = "t.test" |
| 2 | Wilcoxon rank-sum (or signed-rank if paired = TRUE) |
Welch two-sample t-test (or paired t-test) |
\ge 3 | Kruskal-Wallis | One-way ANOVA (Welch) |
When there are three or more groups and posthoc = TRUE, pairwise
follow-up tests are run (Wilcoxon or Welch t-test) with p.adjust
multiple-testing correction.
Value
A list with:
resultsData frame with one row per
target: omnibus test name, statistic,p.value, and group information.summaryPer-group descriptive statistics (
n,mean,sd,median).pairwisePairwise comparisons when
posthoc = TRUEand there are\ge3 groups; otherwiseNULL.
Author(s)
Junhui Li
Examples
## Not run:
library(GenomicRanges)
set.seed(1)
gr <- GRanges(
seqnames = rep("chr1", 90),
ranges = IRanges(start = sort(sample(1e6, 90)), width = 50),
Tm = c(rnorm(30, 74, 2), rnorm(30, 70, 2), rnorm(30, 66, 2)),
GC = runif(90, 40, 60)
)
gr$group <- rep(c("high", "mid", "low"), each = 30)
# Two groups
gr2 <- gr[gr$group %in% c("high", "low")]
compare_groups(gr2, target = "Tm", group = "group", posthoc = FALSE)
# Three or more groups (Kruskal-Wallis + pairwise Wilcoxon)
compare_groups(gr, target = c("Tm", "GC"), group = "group",
method = "wilcoxon")
# Three or more groups (one-way ANOVA + pairwise t-tests)
compare_groups(gr, target = "Tm", group = "group", method = "t.test")
# Post-hoc with Benjamini-Hochberg FDR control
compare_groups(gr, target = "Tm", group = "group",
p.adjust.method = "BH")
## End(Not run)
Fast complement and reverse complement
Description
Uses chartr() instead of character-by-character translation. ~10x faster than the seqinr-style implementation for long sequences.
Usage
complement_fast(seq_str, rev = FALSE)
Arguments
seq_str |
Character string or vector. |
rev |
Logical. Return reverse complement? Default FALSE. |
Value
Character string(s) with complement.
Convert genomic coordinate strings to a GRanges object
Description
Fast conversion of genomic coordinate strings to a GRanges object with
reference sequences fetched from installed BSgenome.* packages.
Designed for large sliding-window inputs: genome packages are loaded once,
coordinate strings are parsed in one pass, and sequences are extracted with
vectorized getSeq (or optional chromosome
preloading).
Usage
coor_to_genomic_ranges(
input,
complement_seq = NULL,
method = c("vectorized", "preload_chr")
)
Arguments
input |
Coordinate input. Either:
Supported colon-separated formats:
|
complement_seq |
Optional complement coordinates in the same format as
|
method |
Sequence extraction strategy:
|
Details
For genome-wide tiling with thousands of windows, pass coordinates as
list(pkg_name = "BSgenome.Hsapiens.UCSC.hg38", seq = ...) so the
genome package is loaded once instead of per interval.
Value
A GRanges object with metadata columns:
sequenceReference sequence for each interval.
complementComplementary sequence.
GCGC percentage (0-100) per interval, computed as
100 * (G+C)/(A+C+G+T)so that N is excluded from the denominator.region_idRegion identifier from the coordinate string.
genome_pkgBSgenome package name used.
Author(s)
Junhui Li
See Also
to_genomic_ranges, to_genomic_ranges_fast
Examples
## Not run:
coords <- c(
"chr1:1000-1199:+:win1",
"chr1:1200-1399:+:win2"
)
gr <- coor_to_genomic_ranges(
list(pkg_name = "BSgenome.Hsapiens.UCSC.hg38", seq = coords)
)
gr
## End(Not run)
E. coli K-12 MG1655 replication-associated hotspot annotations
Description
A named list of genomic feature tables for *Escherichia coli* K-12 MG1655
(NCBI assembly GCF_000005845.2 / ASM584v2, chromosome U00096.3).
The data support the genome-wide Tm vignette and
plot_genome_track examples by providing independent multi-omics
layers that can be overlaid on the same genomic axis alongside Tm profiles
computed with tm_calculate.
Usage
ecoli_rep_hotspots
Format
A named list with five elements:
all_peaks_IP_mutHA data frame (38 rows) of MutL protein ChIP-seq peaks marking mismatch-repair-associated regions (MutL-AR). Columns:
chr,start,end,Sample,name,Size.bins_repA data frame (4,642 rows) of tandem-repeat (microsatellite) counts in non-overlapping 1 kb bins. Columns:
chr,start,end,count.bins_cruA data frame (4,642 rows) of cruciform-forming sequence counts in non-overlapping 1 kb bins. Columns:
chr,start,end,count.ssdnaA data frame (2,636 rows) of single-stranded DNA regions. Columns:
chr,start,end,Cells..strand.,Region.bins_gatcA data frame (4,642 rows) of GATC methylation-site counts in non-overlapping 1 kb bins. Columns:
chr,start,end,count.
All coordinate-based tables use chr = "U00096.3" and are compatible
with plot_genome_track and compare_groups.
Source
Curated from published *E. coli* K-12 MG1655 multi-omics datasets
used in the package vignette
vignette("genome_wide_tm_ecoli", package = "TmCalculator").
Examples
data(ecoli_rep_hotspots)
names(ecoli_rep_hotspots)
# MutL-AR peak coordinates
head(ecoli_rep_hotspots$all_peaks_IP_mutH)
# Microsatellite density in 1 kb bins
summary(ecoli_rep_hotspots$bins_rep$count)
Convert FASTA file to GenomicRanges object
Description
This function reads sequences from a FASTA file and converts them to a GenomicRanges object. If named with format ">chr2:1-10:[+|-]:[seq_name]", the name will be parsed into GRanges components.
Usage
fa_to_genomic_ranges(input_seq)
Arguments
input_seq |
Path to the input FASTA file |
Value
A GenomicRanges object containing: - GRanges information (seqnames, ranges, strand) - sequence data from FASTA file - Complementary sequences (if provided) - Names from FASTA headers
Examples
# Example with single FASTA file
input_seq <- system.file("extdata", "example1.fasta", package = "TmCalculator")
gr <- fa_to_genomic_ranges(input_seq)
Calculate G and C content of nucleotide sequences
Description
Calculate G and C content of nucleotide sequences. The function calculates the percentage of G and C bases relative to the total number of A, T, G, and C bases in the sequence.
Usage
gc_content(input_seq, ambiguous = FALSE)
Arguments
input_seq |
Sequence (5' to 3') of one strand of the nucleic acid duplex. Can be provided as either: - A character string (e.g., "ATGCG") - A path to a FASTA file containing the sequence(s) |
ambiguous |
Logical. If TRUE, ambiguous bases are taken into account when computing the G and C content. The function handles various ambiguous bases (S, W, M, K, R, Y, V, H, D, B) by proportionally distributing their contribution to GC content based on their possible nucleotide compositions. For example: - S (G or C) contributes fully to GC content - W (A or T) contributes fully to AT content - M (A or C) contributes proportionally based on the ratio of A to C in the sequence - And so on for other ambiguous bases |
Value
Content of G and C as a percentage (range from 0 to 100
Author(s)
Junhui Li
Examples
# Calculate GC content of a DNA sequence
gc_content(c("a","t","c","t","g","g","g","c","c","a","g","t","a")) # 53.85%
# Calculate GC content including ambiguous bases
gc_content("GCATSWSYK", ambiguous = TRUE) # 55.56%
Generate complementary sequence
Description
Generate the complementary sequence of a nucleic acid sequence, with an option to reverse it.
Usage
generate_complement(input_seq, reverse = FALSE)
Arguments
input_seq |
Input sequence(s) in 5' to 3' direction. Must be provided as either: - A character string (e.g., c("ATGCG", "GCTAG")) |
reverse |
Logical, controlling which of the two ways of writing the opposite strand is returned.
input 5'-A T G C G-3' reverse = FALSE T A C G C (3' to 5', pairs position by position) reverse = TRUE 5'-C G C A T-3' (the same strand, written 5' to 3') |
Value
Returns the complementary sequence(s) in the specified direction.
Author(s)
Junhui Li
References
citation("TmCalculator")
Examples
# Plain complement: pairs position by position, reads 3' to 5'
generate_complement("ATGCG", reverse = FALSE)
# Reverse complement: the same strand written 5' to 3'
generate_complement("ATGCG", reverse = TRUE)
Integrate a Tm GRanges with multi-omic feature ranges
Description
Combines the output of tm_calculate (a GRanges object with
Tm and GC columns) with a second GRanges carrying
arbitrary multi-omic metadata (ChIP-seq peaks, ATAC-seq signal, methylation
sites, gene annotations, etc.) using one of four positional strategies:
"overlap"Each tm range is annotated with the aggregated metadata of all feature ranges it directly overlaps.
"nearest"Each tm range is annotated with the metadata of its single closest feature range, plus an added distance column.
"window"Each tm range is expanded symmetrically by
window_sizebp and annotated with aggregated metadata from all features that fall within the expanded window."bin"The genomic space covered by the data is tiled into equal-width bins. Each bin is annotated with the mean tm / GC of overlapping tm ranges and the aggregated feature values - suitable for joint heatmaps and genome-wide correlation analyses.
For strategies "overlap" and "window", when a single Tm range
matches multiple features the default behaviour is to summarise:
numeric columns are aggregated via agg_fun (default mean),
and categorical columns are collapsed to a comma-separated string of unique
values.
Usage
integrate_granges(
gr_tm,
gr_features,
strategy = c("overlap", "nearest", "window", "bin"),
feature_cols = NULL,
prefix = "",
window_size = 1000L,
bin_size = 1e+06,
agg_fun = mean,
weight = c("none", "overlap"),
report_coverage = FALSE,
min_overlap = 1L,
ignore_strand = TRUE,
keep_unmatched = TRUE,
distance_col = "distance_to_feature"
)
Arguments
gr_tm |
A |
gr_features |
A |
strategy |
Character. Integration strategy. One of
|
feature_cols |
Character vector. Names of metadata columns in
|
prefix |
Character. Prefix prepended to transferred column names to
avoid clashes with existing columns in |
window_size |
Integer. Half-width (bp) of the symmetric window added
around each Tm range in |
bin_size |
Integer. Width (bp) of genomic bins in |
agg_fun |
Function. Applied to numeric feature values when multiple
features map to the same Tm range / bin. It is called as
|
weight |
Character. How features are combined within a range.
The distinction matters wherever a signal changes sharply. A 200 bp
window whose first 190 bp are covered at depth 5 and whose last 10 bp are
covered at depth 200 has a true mean depth of 14.75; unweighted
aggregation returns 102.5, because the 10 bp feature counts as much as
the 190 bp one. Raising
|
report_coverage |
Logical. Add a |
min_overlap |
Integer. Minimum overlap in base pairs required between
a Tm range and a feature range. It is a filter and not a weight: a
feature either qualifies or does not, and a qualifying feature counts in
full. Applies to the |
ignore_strand |
Logical. If |
keep_unmatched |
Logical. In |
distance_col |
Character. Name of the distance column added in
|
Value
-
"overlap","nearest","window": AGRangesobject with the same ranges asgr_tm(minus unmatched ranges ifkeep_unmatched = FALSE), with additional metadata columns fromgr_features. -
"bin": A newGRangesof genomic bins. Each bin carriesTm_mean,GC_mean(if available),n_tm_ranges,n_features, and one aggregated column per requested feature column.
Aggregating continuous signals
When several features map to the same range, numeric columns are summarised
by agg_fun and character columns are joined as their unique values.
Which features take part is decided by min_overlap, and how much each
one counts is decided by weight. The two are easy to confuse, and the
distinction is what determines whether a coverage-like signal is summarised
correctly at a boundary.
Let R_i be the i-th range of gr_tm, F_j the
j-th feature, x_j its value, and w_{ij} the number of
base pairs R_i and F_j share. Write m for
min_overlap and f for agg_fun. The features entering
the summary of R_i are those with w_{ij} \ge m, and
v_i = f(\{x_j : w_{ij} \ge m\})
with weight = "none", or
v_i = \frac{\sum_j w_{ij} x_j}{\sum_j w_{ij}}
taken over the same features, with weight = "overlap".
The unweighted form gives a feature that overlaps by one base pair the same
influence as one that spans the whole range. This is harmless where a signal
is flat and wrong where it steps, which is to say at exon boundaries, peak
edges and promoters. Raising min_overlap does not repair it: the
threshold is a filter, so a short feature is either counted in full or
discarded in full, and the bias changes sign rather than disappearing. The
example below shows both failures against a case with a known answer.
The weighted mean normalises by the covered base pairs, not by the width of
the range, so a value derived from a quarter of a window is
indistinguishable from one derived from all of it.
report_coverage = TRUE adds a covered_frac column giving the
fraction of each range covered by at least one feature, computed after
reduce-ing the features so that overlapping
ones are not double counted. Multiply by it to convert a mean over covered
bases into a mean over the range.
Weighting is not the default. Enabling it changes numeric output, and existing analyses should stay reproducible unless their author decides otherwise.
Author(s)
Junhui Li
Examples
## Aggregation: a coverage track with a known answer -----------------------
## Two 200 bp windows over a signal that steps sharply inside the first.
##
## window 1 [ 1 .. 200] window 2 [401 .. 600]
## depth [ 1 .. 190] = 5
## [191 .. 400] = 200
## [401 .. 450] = 60
library(GenomicRanges)
win <- GRanges("chr1", IRanges(start = c(1, 401), width = 200),
Tm = c(70, 72))
cov <- GRanges("chr1", IRanges(start = c(1, 191, 401),
end = c(190, 400, 450)),
cov = c(5, 200, 60))
## Window 1 truly averages (5 * 190 + 200 * 10) / 200 = 14.75.
integrate_granges(win, cov, strategy = "overlap")$cov
## 102.5 60 the 10 bp feature counts as much as the 190 bp one
integrate_granges(win, cov, strategy = "overlap",
weight = "overlap")$cov
## 14.75 60 overlap-weighted mean recovers the true depth
integrate_granges(win, cov, strategy = "overlap", min_overlap = 20L)$cov
## 5 60 the threshold discards the short feature; bias reverses
## Window 2 is only a quarter covered. Weighting cannot show that, because
## it normalises by the covered bases; the coverage column can.
res <- integrate_granges(win, cov, strategy = "overlap",
weight = "overlap", report_coverage = TRUE)
res$cov # 14.75 60
res$covered_frac # 1.00 0.25
res$cov * res$covered_frac # 14.75 15 mean over the whole window
## Not run:
library(GenomicRanges)
# -- Sample data ----------------------------------------------------------
set.seed(42)
gr_tm <- GRanges(
seqnames = c(rep("chr1", 60), rep("chr2", 30)),
ranges = IRanges(
start = c(sort(sample(1:249e6, 60)),
sort(sample(1:243e6, 30))),
width = sample(50:200, 90, replace = TRUE)
),
Tm = runif(90, 55, 85),
GC = runif(90, 30, 70)
)
gr_features <- GRanges(
seqnames = c(rep("chr1", 40), rep("chr2", 20)),
ranges = IRanges(
start = c(sort(sample(1:249e6, 40)),
sort(sample(1:243e6, 20))),
width = sample(500:5000, 60, replace = TRUE)
),
score = runif(60, 0, 100),
peak_type = sample(c("narrow", "broad"), 60, replace = TRUE),
signal = rnorm(60, 5, 2)
)
# Strategy 1: overlap - annotate Tm ranges with overlapping peak features
res_overlap <- integrate_granges(gr_tm, gr_features,
strategy = "overlap")
# Strategy 2: nearest - every Tm range gets its closest peak + distance
res_nearest <- integrate_granges(gr_tm, gr_features,
strategy = "nearest")
head(res_nearest$distance_to_feature)
# Strategy 3: window - 5 kb window around each probe
res_window <- integrate_granges(gr_tm, gr_features,
strategy = "window", window_size = 5000)
# Strategy 4: bin - 500 kb genome bins with mean Tm and aggregated signal
res_bin <- integrate_granges(gr_tm, gr_features,
strategy = "bin", bin_size = 5e5)
as.data.frame(res_bin) |> head()
# Use a subset of feature columns and add a prefix
integrate_granges(gr_tm, gr_features,
strategy = "overlap",
feature_cols = c("score", "peak_type"),
prefix = "chip_")
## End(Not run)
Generate sliding-window genomic coordinate strings for Tm calculation
Description
Tiles one or more chromosomes from a BSgenome object into
overlapping windows and returns a named character vector of coordinate
strings in the format
"chr:start-end:strand:genome_pkg:region_id".
This vector is the primary input for downstream Tm calculation
functions (tm_nn, tm_gc, tm_wallace) that
accept genomic coordinate strings.
Usage
make_genomiccoord(
bsgenome,
chromosomes = NULL,
window = 200L,
slide = 50L,
start = NULL,
end = NULL,
strand = "+",
trim_N = c("ends", "filter", "none"),
max_N_frac = 0.1,
N_scan_block = window,
region_prefix = "region",
genome_pkg_name = NULL,
as_vector = TRUE,
verbose = TRUE
)
Arguments
bsgenome |
A |
chromosomes |
Character vector of chromosome names to tile.
Must be present in |
window |
Integer. Width of each sliding window in base
pairs. Default |
slide |
Integer. Step size between consecutive window
starts in base pairs. |
start |
Integer or |
end |
Integer or |
strand |
Character. Strand label embedded in the
coordinate string. One of |
trim_N |
Character. N-base handling strategy. One of
|
max_N_frac |
Numeric in |
N_scan_block |
Integer. Block size (bp) for the in-memory N-end
detection scan used by |
region_prefix |
Character. Prefix for region IDs embedded in
the coordinate string. Default |
genome_pkg_name |
Character or |
as_vector |
Logical. When |
verbose |
Logical. Print per-chromosome progress messages.
Default |
Value
When as_vector = TRUE (default): a named character
vector of coordinate strings, one element per window. Names are
the region IDs (region1, region2, ...).
When as_vector = FALSE: a data.frame with columns
coord, chr, win_start, win_end,
strand, genome, region_id,
chr_start_used, chr_end_used.
Coordinate string format
Each element of the returned vector follows the pattern:
chr1:10001-10200:+:BSgenome.Hsapiens.UCSC.hg38:region1 chr1:10051-10250:+:BSgenome.Hsapiens.UCSC.hg38:region2 ...
Fields (colon-separated):
-
chromosome – e.g.
chr1 -
start-end – 1-based, inclusive coordinates
-
strand –
+or- -
genome – BSgenome package name (character)
-
region_id – unique label
regionN
N-base trimming
Human (and most mammalian) chromosomes begin and end with long
stretches of N bases that represent assembly gaps. Windows
that consist entirely or predominantly of Ns produce
meaningless Tm values. The function offers two trimming strategies
controlled by trim_N:
"none"No trimming. Windows start at
startand end atend(or chromosome length)."ends"Detect the first and last positions of non-
Nbases on each chromosome usingBiostrings::letterFrequency()on a coarse block scan, then trimstartandendto those positions. Efficient: reads the chromosome sequence only once in blocks."filter"Generate windows across the full
start-endrange but then remove any window whose N-base fraction exceedsmax_N_frac(default 0.1, i.e. 10%). More granular than"ends"but slower because it reads each window sequence.
Author(s)
Junhui Li
See Also
tm_nn, tm_gc,
tm_wallace, BSgenome,
letterFrequency
Examples
## Not run:
library(BSgenome.Hsapiens.UCSC.hg38)
## -- Basic usage: tile chr1 with 200 bp windows, 50 bp slide ----------
coords <- make_genomiccoord(
bsgenome = BSgenome.Hsapiens.UCSC.hg38,
chromosomes = "chr1",
window = 200L,
slide = 50L
)
length(coords) # number of windows on chr1
head(coords, 3)
# region1 "chr1:10001-10200:+:BSgenome.Hsapiens.UCSC.hg38:region1"
# region2 "chr1:10051-10250:+:BSgenome.Hsapiens.UCSC.hg38:region2"
# region3 "chr1:10101-10300:+:BSgenome.Hsapiens.UCSC.hg38:region3"
## -- Non-overlapping tiling (slide == window) -------------------------
coords_nonoverlap <- make_genomiccoord(
bsgenome = BSgenome.Hsapiens.UCSC.hg38,
chromosomes = paste0("chr", 1:22),
window = 200L,
slide = 200L # no overlap
)
length(coords_nonoverlap) # ~15 million windows across autosomes
## -- Custom start/end (e.g. a specific sub-region) --------------------
coords_sub <- make_genomiccoord(
bsgenome = BSgenome.Hsapiens.UCSC.hg38,
chromosomes = "chr1",
window = 200L,
slide = 50L,
start = 1000000L,
end = 2000000L
)
length(coords_sub) # 19,981 windows in 1 Mb region
## -- No N-trimming (use full chromosome length) ------------------------
coords_noN <- make_genomiccoord(
bsgenome = BSgenome.Hsapiens.UCSC.hg38,
chromosomes = "chr1",
window = 200L,
slide = 50L,
trim_N = "none"
)
## -- Per-window N-filtering (removes windows with >10% N) -------------
coords_filt <- make_genomiccoord(
bsgenome = BSgenome.Hsapiens.UCSC.hg38,
chromosomes = "chr1",
window = 200L,
slide = 50L,
trim_N = "filter",
max_N_frac = 0.10
)
## -- Get data.frame output for GRanges construction -------------------
df <- make_genomiccoord(
bsgenome = BSgenome.Hsapiens.UCSC.hg38,
chromosomes = "chr1",
window = 200L,
slide = 50L,
as_vector = FALSE
)
gr <- GenomicRanges::GRanges(
seqnames = df$chr,
ranges = IRanges::IRanges(start = df$win_start, end = df$win_end),
strand = df$strand
)
## -- Pass directly to tm_nn -------------------------------------------
coords <- make_genomiccoord(
bsgenome = BSgenome.Hsapiens.UCSC.hg38,
chromosomes = "chr1",
window = 200L,
slide = 200L,
start = 1000000L,
end = 1010000L
)
tm_results <- tm_nn(coords, Na = 50)
## End(Not run)
Plot genome tracks in linear or circular layout
Description
Visualise genomic tracks as either a linear karyoploteR plot or a circular
plot (base R graphics).
Set circular = TRUE to switch to the circular layout; the same
track_list works for both views without modification.
Supported track types in each list element:
type = "rect" : data as GRanges/data.frame, drawn as rectangles
type = "line" : data as GRanges/data.frame with value_col, drawn as lines
type = "area" : same as line but filled (linear only)
type = "region": piled-up regions (linear only)
type = "coverage": coverage area plot (linear only)
A track with ideogram = TRUE is drawn inside the chromosome bar
(linear) or as the outermost ring with a grey background (circular).
Only "rect" type is supported for ideogram tracks.
A per-track height field (numeric, default 1) controls relative
sizing. In linear mode heights are proportional fractions of the data
panel; in circular mode they scale the radial thickness of each ring.
A per-track highlight field (list or list-of-lists with
data/col/alpha/border) draws highlight bands within that track only.
Entries with type = "highlight" draw translucent bands spanning
all real tracks. These accept: data, col (default "#F1C40F"),
alpha (default 0.18), border (default NA), and min.degree (circular only,
default 0.4).
Each list element may also contain: name, col, bg.col, border, ylim, lwd, alpha (0–1 transparency), legend_font_col, ideogram, height, highlight.
Usage
plot_genome_track(
genome_name,
genome_size = NULL,
genome = NULL,
track_list,
circular = FALSE,
label = NULL,
chromosomes = NULL,
zoom = NULL,
plot.type = 1,
plot.params = NULL,
main = NULL,
track.gap = 0.01,
legend.show = TRUE,
legend.position = NULL,
legend.cex = 0.6,
legend.bty = "n",
legend.border = NA,
legend.font.col = "black",
legend.lwd = 1,
legend.seg.len = -0.5,
legend.box.lwd = 0.25,
legend.x.intersp = 1,
legend.lty = 1,
axis.cex = NULL,
title.cex = NULL,
base.tick.dist = NULL,
base.tick.units = TRUE,
start.degree = 34.47,
track.height = 0.05,
gap.after = 0,
cell.padding = c(0, 0, 0, 0),
track.margin = c(0.005, 0.005),
circle.margin = c(0.001, 0.001),
canvas.xlim = c(-1, 1),
canvas.ylim = c(-1, 1),
axis.unit = "Mb",
axis.step = NULL,
axis.show.unit = FALSE,
label.column = 4,
label.niceFacing = TRUE,
label.cex = 0.6,
label.side = "inside",
label.labels_height = 0.01,
label.connection_height = 0.03,
label.line_lwd = 0.25
)
Arguments
genome_name |
Character. Used for the title. |
genome_size |
Numeric. Total genome length (single-chromosome genomes). |
genome |
Optional GRanges, or a karyoploteR genome string (e.g.
|
track_list |
List of track specs (see above). |
circular |
Logical. If |
label |
Optional data.frame/GRanges with labels. |
chromosomes |
Character vector to restrict/reorder chromosomes (linear only). |
zoom |
A GRanges object, a character string, or a character vector
specifying one or more regions to zoom into (e.g.
|
plot.type |
karyoploteR plot.type (linear only). |
plot.params |
Optional named list overriding entries of
|
main |
Panel title. |
track.gap |
Relative gap between tracks (linear only, 0 to ~0.05). |
legend.show |
Logical. |
legend.position |
Legend position. Character for linear (e.g. "topright"), numeric vector of length 2 for circular (e.g. c(0.75, 1)). |
legend.cex, legend.bty, legend.border |
See |
legend.font.col |
Character. Default legend text colour. |
legend.lwd, legend.seg.len, legend.box.lwd, legend.x.intersp, legend.lty |
Additional legend parameters. |
axis.cex |
Axis label size. |
title.cex |
Title size. |
base.tick.dist |
Numeric or NULL (linear only). |
base.tick.units |
Logical (linear only). Append the unit to the base
position labels, so that an axis reads |
start.degree |
Numeric. Starting angle in degrees for the circular layout (default 34.47, matching the circlize convention). |
track.height, gap.after, cell.padding, track.margin |
Kept for backward compatibility; ignored in the base R circular layout. |
circle.margin |
Numeric vector (length 2 or 4) controlling plot margins
as fractions of the device size. Length 2 is recycled as
|
canvas.xlim, canvas.ylim |
Numeric length-2 vectors controlling the plotting window (circular only). Adjust to pan or zoom into a portion of the circle. |
axis.unit, axis.step, axis.show.unit |
Circular axis parameters. |
label.column, label.niceFacing, label.cex, label.side, label.labels_height, label.connection_height, label.line_lwd |
Circular label parameters. |
Value
Invisibly returns the KaryoPlot object (linear) or NULL
(circular).
Examples
## Not run:
data(ecoli_rep_hotspots)
library("BSgenome.Ecoli.NCBI.ASM584v2")
genome_name <- "BSgenome.Ecoli.NCBI.ASM584v2"
chr_name <- "U00096.3"
genome <- get(genome_name, envir = asNamespace(genome_name))
chr_length <- length(genome[[chr_name]])
genome_name="BSgenome.Ecoli.NCBI.ASM584v2"
bins_gc <- make_genomiccoord(
bsgenome = genome_name,
chromosomes = chr_name,
window = 200L,
slide = 200L,
start = 1,
end = chr_length,
strand = "+"
)
input_new <- list(pkg_name = genome_name, seq = bins_gc)
gr_batch <- to_genomic_ranges_fast(input_new)
tm_ASM584v2 <- tm_calculate(
gr_batch,
method = "tm_nn"
)
Tm <- as.data.frame(tm_ASM584v2$gr[, c("Tm", "GC")])
tracks <- list(
list(type = "rect", data = ecoli_rep_hotspots$all_peaks_IP_mutH,
col = "#2C3E50", bg.col = "grey", name = "MutL-AR",
legend_font_col = "#2C3E50", ideogram = TRUE, height = 0.5),
list(type = "line", data = Tm, value_col = "GC",
name = "GC content", col = "#4A90E2",
legend_font_col = "#4A90E2"),
list(type = "line", data = Tm, value_col = "Tm",
name = "Melting temp", col = "#E06666",
legend_font_col = "#E06666", height = 2),
list(type = "line", data = ecoli_rep_hotspots$bins_rep,
value_col = "count", name = "Microsatellites", col = "#2ECC71",
legend_font_col = "#2ECC71"),
list(type = "line", data = ecoli_rep_hotspots$bins_cru,
value_col = "count", name = "Cruciform", col = "#3B3E6B",
legend_font_col = "#3B3E6B"),
list(data = ecoli_rep_hotspots$ssdna, name = "ssDNA",
col = "#8E44AD", legend_font_col = "#8E44AD"),
list(type = "line", data = ecoli_rep_hotspots$bins_gatc,
value_col = "count", name = "GATC sites", col = "#D35400",
legend_font_col = "#D35400"),
list(type = "highlight", data = ecoli_rep_hotspots$all_peaks_IP_mutH,
col = "#F1C40F", alpha = 0.18)
)
# Circular
plot_genome_track("E. coli", genome_size = 4641652,
track_list = tracks, circular = TRUE)
# Linear
plot_genome_track("E. coli", genome_size = 4641652,
track_list = tracks)
# Linear zoom (single region)
plot_genome_track("E. coli", genome_size = 4641652,
track_list = tracks,
zoom = "U00096.3:1000000-2000000")
# Linear zoom (multiple regions — stacked panels)
plot_genome_track("E. coli", genome_size = 4641652,
track_list = tracks,
zoom = c("U00096.3:1000000-1200000",
"U00096.3:3000000-3200000"))
# Circular zoom (multiple regions — concatenated arcs)
plot_genome_track("E. coli", genome_size = 4641652,
track_list = tracks, circular = TRUE,
zoom = c("U00096.3:1000000-1200000",
"U00096.3:3000000-3200000"))
# Circular with canvas panning
plot_genome_track("E. coli", genome_size = 4641652,
track_list = tracks, circular = TRUE,
canvas.xlim = c(0.5, 1), canvas.ylim = c(0, 1),
circle.margin = c(0.05, 0.05))
## End(Not run)
Compare Tm distributions across groups
Description
Visualise how melting temperature (and optionally other numeric metadata)
differs between region classes such as peak vs. non-peak, mutant vs.
wild-type, or any categorical annotation stored in a GRanges object.
Designed as the visual companion to compare_groups().
Usage
plot_tm(
gr,
group,
value = "Tm",
plot_type = c("box", "violin", "rank", "density", "ridgeline", "ecdf", "sina"),
color_palette = c("viridis", "magma", "plasma", "inferno", "cividis"),
show_points = FALSE,
point_size = 1,
point_alpha = 0.3,
notch = FALSE,
add_mean = FALSE,
facet_by = NULL,
show_pvalue = FALSE,
p_adjust_method = "BH",
title = NULL,
ylab = "Tm (°C)",
xlab = NULL,
show_legend = TRUE
)
Arguments
gr |
A |
group |
Character. Name of the metadata column that defines the groups
to compare (e.g. |
value |
Character. Numeric metadata column to plot on the y-axis.
Default: |
plot_type |
Character. Visualisation style:
|
color_palette |
Character. Viridis palette for group colours:
|
show_points |
Logical. Overlay jittered points on box / violin plots.
Default: |
point_size |
Numeric. Point size. Default: |
point_alpha |
Numeric in |
notch |
Logical. Draw notched box plots (approximate 95% CI for
median). Default: |
add_mean |
Logical. Add a diamond marker at the group mean on box /
violin plots. Default: |
facet_by |
Character or |
show_pvalue |
Logical. Annotate the plot with Wilcoxon rank-sum test
p-values. For two groups a single p-value is shown; for three or more
groups all pairwise comparisons are displayed. P-values are placed as
bracket annotations on box / violin / sina plots, or as a subtitle on
density / ecdf / rank / ridgeline plots. Default: |
p_adjust_method |
Character. Method for p-value adjustment when there
are more than two groups (passed to |
title |
Character or |
ylab |
Character. Y-axis label. Default: |
xlab |
Character. X-axis label. Default: group column name for
box/violin/sina, |
show_legend |
Logical. Show colour legend. Default: |
Details
The function pairs naturally with integrate_granges() and
compare_groups():
Use
integrate_granges()to annotate Tm windows with feature overlaps (e.g. ChIP-seq peaks, repeat classes).Use
compare_groups()for the statistical test.Use
plot_tm()to visualise the distributional difference.
Value
A ggplot object.
Examples
## Not run:
library(GenomicRanges)
data(ecoli_rep_hotspots)
library("BSgenome.Ecoli.NCBI.ASM584v2")
genome_name <- "BSgenome.Ecoli.NCBI.ASM584v2"
chr_name <- "U00096.3"
genome <- get(genome_name, envir = asNamespace(genome_name))
chr_length <- length(genome[[chr_name]])
genome_name="BSgenome.Ecoli.NCBI.ASM584v2"
bins_gc <- make_genomiccoord(
bsgenome = genome_name,
chromosomes = chr_name,
window = 200L,
slide = 200L,
start = 1,
end = chr_length,
strand = "+"
)
input_new <- list(pkg_name = genome_name, seq = bins_gc)
gr_batch <- to_genomic_ranges_fast(input_new)
tm_ASM584v2 <- tm_calculate(
gr_batch,
method = "tm_nn"
)
gr_tm <- tm_ASM584v2$gr
# Annotate with MutL-AR peak membership
mutH_peaks <- GRanges(
seqnames = ecoli_rep_hotspots$all_peaks_IP_mutH$chr,
ranges = IRanges(start = ecoli_rep_hotspots$all_peaks_IP_mutH$start,
end = ecoli_rep_hotspots$all_peaks_IP_mutH$end)
)
mutH_peaks$peak_id <- paste0("mutH_", seq_along(mutH_peaks))
gr_annot <- integrate_granges(
gr_tm = gr_tm, gr_features = mutH_peaks,
strategy = "overlap", feature_cols = "peak_id",
keep_unmatched = TRUE
)
gr_annot$in_mutH <- ifelse(is.na(gr_annot$peak_id), "non_peak", "peak")
# Box plot — peak vs non-peak Tm
plot_tm(gr_annot, group = "in_mutH")
# Box plot with Wilcoxon p-value bracket
plot_tm(gr_annot, group = "in_mutH", show_pvalue = TRUE)
# Violin plot with p-value and jittered points
plot_tm(gr_annot, group = "in_mutH", plot_type = "violin",
show_points = TRUE, show_pvalue = TRUE)
# Rank plot — visual Wilcoxon test with p-value subtitle
plot_tm(gr_annot, group = "in_mutH", plot_type = "rank",
show_pvalue = TRUE)
# Density overlay with p-value
plot_tm(gr_annot, group = "in_mutH", plot_type = "density",
show_pvalue = TRUE)
# ECDF — cumulative distribution comparison
plot_tm(gr_annot, group = "in_mutH", plot_type = "ecdf",
show_pvalue = TRUE)
# Compare GC content instead of Tm
plot_tm(gr_annot, group = "in_mutH", value = "GC", ylab = "GC content",
show_pvalue = TRUE)
# Notched box plot with mean markers and p-value
plot_tm(gr_annot, group = "in_mutH", notch = TRUE, add_mean = TRUE,
show_pvalue = TRUE)
## End(Not run)
Prints melting temperature from a TmCalculator object
Description
print.TmCalculator prints to console the melting temperature value from an object of
class TmCalculator.
Usage
## S3 method for class 'TmCalculator'
print(x, ...)
Arguments
x |
An object of class |
... |
Unused |
Value
The melting temperature value.
convert a string into a vector of characters
Description
Simply convert a single string such as "HelloWorld" into a vector of characters such as c("H","e","l","l","o","W","o","r","l","d")
Usage
s2c(strings)
Arguments
strings |
A single string such as "HelloWorld" |
Value
Retrun a vector of characters
Author(s)
Junhui Li
References
citation("TmCalculator")
Corrections of melting temperature with salt concentration
Description
Apply corrections to melting temperature calculations based on salt concentrations. Different correction methods are available for various experimental conditions.
Usage
salt_correct(
Na = 0,
K = 0,
Tris = 0,
Mg = 0,
dNTPs = 0,
method = c("Schildkraut2010", "Wetmur1991", "SantaLucia1996", "SantaLucia1998-1",
"SantaLucia1998-2", "Owczarzy2004", "Owczarzy2008"),
input_seq,
ambiguous = FALSE
)
Arguments
Na |
Millimolar concentration of sodium ions. Default: 0 |
K |
Millimolar concentration of potassium ions. Default: 0 |
Tris |
Millimolar concentration of Tris buffer. Default: 0 |
Mg |
Millimolar concentration of magnesium ions. Default: 0 |
dNTPs |
Millimolar concentration of deoxynucleotide triphosphates. Default: 0 |
method |
Method for calculating salt concentration corrections to the melting temperature. Available options: - "Schildkraut2010": Schildkraut & Lifson (1965); historical identifier - "Wetmur1991": Classic salt correction method - "SantaLucia1996": DNA-specific salt correction - "SantaLucia1998-1": Improved DNA salt correction - "SantaLucia1998-2": Alternative DNA salt correction (requires input_seq) - "Owczarzy2004": Comprehensive salt correction (requires input_seq) - "Owczarzy2008": Updated comprehensive salt correction (requires input_seq) Note: Setting to NA disables salt correction |
input_seq |
Sequence (5' to 3') of one strand of the nucleic acid duplex. Can be provided as either: - A character string (e.g., "ATGCG") - A path to a FASTA file containing the sequence(s) Required for methods: "SantaLucia1998-2", "Owczarzy2004", and "Owczarzy2008" |
ambiguous |
Logical. If TRUE, ambiguous bases are taken into account when computing the G and C content. The function handles various ambiguous bases (S, W, M, K, R, Y, V, H, D, B) by proportionally distributing their contribution to GC content based on their possible nucleotide compositions. |
Details
Different correction methods are available for various experimental conditions:
- Schildkraut2010: Schildkraut & Lifson (1965) monovalent correction; the name is historical - Wetmur1991: Classic salt correction method for monovalent cations - SantaLucia1996: DNA-specific salt correction - SantaLucia1998-1: Improved DNA salt correction - SantaLucia1998-2: Alternative DNA salt correction (requires sequence information) - Owczarzy2004: Sodium correction from Owczarzy et al. (2004) (requires sequence information) - Owczarzy2008: Updated comprehensive salt correction (requires sequence information)
For methods other than Owczarzy2008, the sodium-equivalent magnesium adjustment follows von Ahsen et al. (2001); it is separate from the original monovalent formulas.
Owczarzy2008 is piecewise. Which of its three forms applies is decided by
the ratio R = \sqrt{[Mg^{2+}]_{free}} / [Mon], where [Mon] is
the total monovalent concentration in molar and the free magnesium is what
is left after chelation by dNTPs (K_a = 3 \times 10^4
M^{-1}). Below 0.22 the monovalent term alone applies; between 0.22
and 6 a competing form whose coefficients are themselves functions of
[Mon]; at 6 and above the divalent-dominated form, in which
[Mon] drops out of the expression entirely. A solution with
magnesium and no monovalent cation at all therefore has a defined
correction rather than none.
Author(s)
Junhui Li
References
Schildkraut C, Lifson S. Dependence of the melting temperature of DNA on salt concentration. Biopolymers. 1965;3(2):195-208.
Wetmur JG. DNA Probes: Applications of the Principles of Nucleic Acid Hybridization. Critical Reviews in Biochemistry and Molecular Biology. 1991;26(3-4):227-259.
SantaLucia J. A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. Proceedings of the National Academy of Sciences. 1998;95(4):1460-1465.
Owczarzy R, Moreira BG, Manthey JA, et al. Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations. Biochemistry. 2008;47(19):5336-5353.
SantaLucia J Jr, Allawi HT, Seneviratne PA (1996). Improved nearest-neighbor parameters for predicting DNA duplex stability. <doi:10.1021/bi951907q>
Owczarzy R et al. (2004). Effects of sodium ions on DNA duplex oligomers: improved predictions of melting temperatures. <doi:10.1021/bi034621r>
von Ahsen N, Wittwer CT, Schutz E (2001). Oligonucleotide melting temperatures under PCR conditions. <doi:10.1093/clinchem/47.11.1956>
Examples
salt_correct(Na = 50, Mg = 1.5, method = "Owczarzy2008",
input_seq = "ATGCGATGCG")
Thermodynamic parameters for GC-based Tm calculation methods
Description
A data frame containing coefficients and parameters for different GC-based Tm calculation methods. Each row represents a different method with its specific coefficients (A, B, C, D) and salt correction method.
Usage
thermodynamic_gc_params
Format
A data frame with 8 rows and 5 columns:
- A
Intercept coefficient
- B
GC content coefficient
- C
Length correction coefficient
- D
Mismatch coefficient
- salt_correct
Associated salt correction method
Details
The methods included are: - Chester1993: Tm = 69.3 + 0.41(Percentage_GC) - 650/N - QuikChange: Tm = 81.5 + 0.41(Percentage_GC) - 675/N - Percentage_mismatch - Schildkraut1965: Tm = 81.5 + 0.41(Percentage_GC) - 675/N + 16.6 x log10[Na+] - Wetmur1991_MELTING: Tm = 81.5 + 0.41(Percentage_GC) - 500/N + Wetmur salt - - Wetmur1991_RNA: Tm = 78 + 0.7(Percentage_GC) - 500/N + Wetmur salt - - Wetmur1991_RNA/DNA: Tm = 67 + 0.8(Percentage_GC) - 500/N + Wetmur salt - - Primer3Plus: Tm = 81.5 + 0.41(Percentage_GC) - 600/N + 16.6 x log10[Na+] - vonAhsen2001: Tm = 77.1 + 0.41(Percentage_GC) - 528/N + 11.7 x log10[Na+]
Thermodynamic Tables for Nucleic Acid Hybridization
Description
A comprehensive collection of thermodynamic parameters used for calculating melting temperatures of nucleic acid duplexes. The dataset includes parameters for DNA/DNA, RNA/RNA, RNA/DNA and 2'-O-methylRNA/RNA hybridizations, plus parameters for mismatches, dangling ends, internal / bulge loops, GU wobble, CNG repeats, inosine, hydroxyadenine, azobenzene and locked nucleic acids (LNA).
Usage
thermodynamic_nn_params
Format
A named list of two-column matrices with
colnames = c("left", "right") (left = \Delta H,
right = \Delta S). Rownames are dinucleotide step keys such as
"AT/TA", mismatch / dangling-end keys, or feature-specific keys
(e.g. "CAG_4" for the (CAG)4 CNG entry).
Populated tables
- DNA_NN_Breslauer_1986
DNA/DNA NN, Breslauer et al. (1986)
- DNA_NN_Sugimoto_1996
DNA/DNA NN, Sugimoto et al. (1996)
- DNA_NN_Allawi_1998
DNA/DNA Watson-Crick NN, Allawi & SantaLucia (1997), Table 1; legacy identifier
- DNA_NN_SantaLucia_2004
DNA/DNA NN, SantaLucia & Hicks (2004)
- RNA_NN_Freier_1986
RNA/RNA NN, Freier (1986)
- RNA_NN_Xia_1998
RNA/RNA NN, Xia (1998)
- RNA_NN_Chen_2012
RNA/RNA NN with GU, Chen / Serra (2012)
- RNA_DNA_NN_Sugimoto_1995
RNA/DNA hybrid NN, Sugimoto (1995)
- DNA_IMM_Peyret_1999
DNA internal mismatches, six sources (1997-2005); see tm_nn
- DNA_TMM_Bommarito_2000
DNA terminal mismatch, SantaLucia & Peyret (2001), WO2001094611A2, Tables 2-3; legacy identifier
- DNA_DE_Bommarito_2000
DNA single dangling end, Bommarito (2000)
- RNA_DE_Turner_2010
RNA single dangling end, NNDB Turner 2004 compilation; database described in 2010
Registered placeholders (values TBD - populate from primary literature)
- DNA_NN_AllSan_1997
Allawi & SantaLucia (1997) Biochemistry 36:10581
- DNA_NN_SantaLucia_1996
SantaLucia et al. (1996) Biochemistry 35:3555
- DNA_NN_Tanaka_2004
Tanaka et al. (2004) Biochemistry 43:7143
- MeRNA_RNA_NN_Kierzek_2006
Kierzek et al. (2006) Biochemistry 45:581
- DNA_RNA_IMM_Watkins_2011
Watkins et al. (2011) Nucleic Acids Res 39:1894
- RNA_IMM_Lu_2006
Lu et al. (2006) Nucleic Acids Res 34:4912
- RNA_IMM_Davis_Znosko_2007
Davis & Znosko (2007) Biochemistry 46:13425
- RNA_IMM_Davis_Znosko_2008
Davis & Znosko (2008) Biochemistry 47:10178
- DNA_TandemMM_AllSanPey
Allawi & SantaLucia (1997/1998); Peyret (1999)
- RNA_TandemMM_Mathews_1999
Mathews et al. (1999) JMB 288:911
- DNA_DE_Ohmichi_2002
Ohmichi et al. (2002) JACS 124:10367
- RNA_DE_Ohmichi_2002
Ohmichi et al. (2002) JACS 124:10367
- RNA_DE_Serra_2008
O'Toole / Serra (2006, 2008)
- DNA_DDE_Ohmichi_2002
Ohmichi et al. (2002) JACS 124:10367
- RNA_DDE_Ohmichi_2002
Ohmichi et al. (2002) JACS 124:10367
- RNA_DDE_OToole_2005
O'Toole et al. (2005) Biochemistry 44:14914
- RNA_DDE_OToole_2006
O'Toole et al. (2006) NAR 34:3338
- DNA_LDE_Ohmichi_2002
Ohmichi et al. (2002) JACS 124:10367
- RNA_LDE_Ohmichi_2002
Ohmichi et al. (2002) JACS 124:10367
- DNA_IL_SantaLucia_2004
SantaLucia & Hicks (2004)
- RNA_IL_Lu_2006
Lu et al. (2006) NAR 34:4912
- RNA_IL_Badhwar_2007
Badhwar et al. (2007) Biochemistry 46:14715
- DNA_SBL_Tanaka_2007
Tan & Chen (2007) Biophys J 92:3615
- DNA_SBL_SantaLucia_2004
SantaLucia & Hicks (2004)
- RNA_SBL_Lu_2006
Lu et al. (2006) NAR 34:4912
- RNA_SBL_Blose_2007
Blose et al. (2007) Biochemistry 46:15123
- DNA_LBL_SantaLucia_2004
SantaLucia & Hicks (2004)
- RNA_LBL_Lu_2006
Mathews (1999); Lu et al. (2006)
- RNA_GU_Mathews_1999
Mathews & Turner (1999) JMB 288:911
- RNA_GU_Chen_2012
Chen / Serra (2012)
- DNA_CNG_Broda_2005
Broda et al. (2005) Biochemistry 44:13851 - rownames use
paste0("C", N, "G_", n), e.g."CAG_4".- DNA_INO_SantaLucia_2005
Watkins & SantaLucia (2005) NAR 33:6258
- RNA_INO_Wright_2007
Wright et al. (2007) Biochemistry 46:4625
- DNA_HA_Kawakami_2001
Kawakami / Sugimoto (2001) Biochemistry 40:14040
- DNA_AZB_Asanuma_2005
Asanuma et al. (2005) Angew Chem Int Ed 44:2747
- DNA_LNA_Owczarzy_2011
Owczarzy et al. (2011) Biochemistry 50:9352
- DNA_LNA_McTigue_2004
McTigue et al. (2004) Biochemistry 43:5388
- DNA_cLNA_Owczarzy_2011
Owczarzy et al. (2011) Biochemistry 50:9352
- DNA_cLNA_MM_Owczarzy_2011
Owczarzy et al. (2011) Biochemistry 50:9352
To add the numeric values for any placeholder table, construct a matrix
with two columns (\Delta H kcal/mol, \Delta S cal/(mol*K)) and
the dinucleotide-step rownames described above, then assign it:
thermodynamic_nn_params$DNA_CNG_Broda_2005 <- new_table
Details
Coverage mirrors the rmelting (Bioconductor) vignette sections 4.2.1 - 4.4.
Tables whose numeric values are not yet ported from primary literature are
included in the list as NULL placeholders so that
tm_nn can still dispatch on the table name; the corresponding
contribution is silently skipped after a one-time package-startup notice.
Source
Various publications as cited above. See the installed
extdata/tm_nn_reference_audit.md for the audit of runtime tables.
References
Breslauer K J (1986) <doi:10.1073/pnas.83.11.3746> Sugimoto N (1996) <doi:10.1093/nar/24.22.4501> Allawi H T & SantaLucia J Jr (1997), Table 1 <doi:10.1021/bi962590c>; also SantaLucia (1998), Table 2 <doi:10.1073/pnas.95.4.1460> SantaLucia J (2004) <doi:10.1146/annurev.biophys.32.110601.141800> Freier S (1986) <doi:10.1073/pnas.83.24.9373> Xia T (1998) <doi:10.1021/bi9809425> Chen JL (2012) <doi:10.1021/bi3002709> Sugimoto N (1995) <doi:10.1021/bi00035a029> Bommarito S (2000) <doi:10.1093/nar/28.9.1929> Peyret N (1999) <doi:10.1021/bi9825091> Allawi H T & SantaLucia J (1997) <doi:10.1021/bi962590c> Watkins N E Jr & SantaLucia J Jr (2005) <doi:10.1093/nar/gki918> Allawi H T & SantaLucia J Jr (1998, G.A) <doi:10.1021/bi9724873> Allawi H T & SantaLucia J Jr (1998, A.C) <doi:10.1021/bi9803729> Allawi H T & SantaLucia J Jr (1998, C.T) <doi:10.1093/nar/26.11.2694> SantaLucia J Jr & Peyret N (2001), WO2001094611A2, Tables 2-3. https://patents.google.com/patent/WO2001094611A2/en Turner D H & Mathews D H (2010) <doi:10.1093/nar/gkp892> Tanaka F (2004) Biochemistry 43:7143 Kierzek E (2006) Biochemistry 45:581 Watkins N E (2011) Nucleic Acids Res 39:1894 Lu Z J (2006) Nucleic Acids Res 34:4912 Davis A R & Znosko B M (2007, 2008) Biochemistry Mathews D H (1999) <doi:10.1006/jmbi.1999.2700> Ohmichi T (2002) J Am Chem Soc 124:10367 O'Toole A S (2005, 2006) Biochemistry / Nucleic Acids Res Badhwar J (2007) Biochemistry 46:14715 Tan Z J & Chen S J (2007) Biophys J 92:3615 Blose J M (2007) Biochemistry 46:15123 Broda M (2005) <doi:10.1021/bi0501447> Wright D J (2007) Biochemistry 46:4625 Kawakami J / Sugimoto N (2001) <doi:10.1021/bi010918b> Asanuma H (2005) Angew Chem Int Ed 44:2747 McTigue P M (2004) Biochemistry 43:5388 Owczarzy R (2011) Biochemistry 50:9352
Examples
# Access DNA/DNA nearest neighbor parameters
thermodynamic_nn_params$DNA_NN_SantaLucia_2004
# Access DNA internal mismatch parameters
thermodynamic_nn_params$DNA_IMM_Peyret_1999
# See which tables are still placeholders (NULL)
names(Filter(is.null, thermodynamic_nn_params))
Calculate melting temperature using multiple methods
Description
Calculates nucleic acid melting temperature (Tm) by one of three methods, and
returns the result as a GRanges object so that Tm can be used directly
as a quantitative genomic feature alongside other assays:
-
Nearest neighbor (
tm_nn) sums the stacking free energies of adjacent base-pair steps using experimentally derived enthalpy and entropy parameters, and so resolves sequences of identical base composition but different order. It supports salt and chemical corrections, mismatches and dangling ends, and is the default. -
GC content (
tm_gc) computes Tm as an empirical function of GC percentage with corrections for length and ionic strength. Cheaper than NN, but blind to sequence order. -
Wallace rule (
tm_wallace) assigns a fixed contribution per base. It is calibrated for short oligonucleotides, typically 14 to 20 bp, and ignores sequence context and reaction conditions, so it is not appropriate for long sequences or for genome-wide windows.
Usage
tm_calculate(
input_seq,
method = c("tm_nn", "tm_gc", "tm_wallace"),
complement_seq = NULL,
ambiguous = FALSE,
shift = 0,
nn_table = c("DNA_NN_SantaLucia_2004", "DNA_NN_Ghosh_2020_PEG200",
"DNA_NN_Breslauer_1986", "DNA_NN_Sugimoto_1996", "DNA_NN_Allawi_1998",
"RNA_NN_Freier_1986", "RNA_NN_Xia_1998", "RNA_NN_Chen_2012", "RNA_NN_Zuber_2022",
"RNA_NN_Ghosh_2023_PEG200", "RNA_DNA_NN_Sugimoto_1995", "DNA_NN_Weber_2015",
"DNA_NN_Weber_OW04_69", "DNA_NN_Weber_OW04_119", "DNA_NN_Weber_OW04_220",
"DNA_NN_Weber_OW04_621", "DNA_NN_Weber_OW04_1020", "RNA_NN_Weber_VIF_71",
"RNA_NN_Weber_VIF_121", "RNA_NN_Weber_VIF_221", "RNA_NN_Weber_VIF_621",
"RNA_NN_Weber_VIF_1021", "RNA_NN_Weber_FIF_71", "RNA_NN_Weber_FIF_121",
"RNA_NN_Weber_FIF_221", "RNA_NN_Weber_FIF_621", "RNA_NN_Weber_FIF_1021",
"RNA_DNA_NN_Weber_2019_FT", "RNA_DNA_NN_Weber_2019_VH", "RNA_DNA_NN_Weber_2019_LS",
"RNA_DNA_NN_Banerjee_2020"),
tmm_table = "DNA_TMM_Bommarito_2000",
imm_table = "DNA_IMM_Peyret_1999",
de_table = c("DNA_DE_Bommarito_2000", "RNA_DE_Turner_2010"),
dnac_high = 25,
dnac_low = 25,
self_comp = FALSE,
variant = c("Primer3Plus", "Chester1993", "QuikChange", "Schildkraut1965",
"Wetmur1991_MELTING", "Wetmur1991_RNA", "Wetmur1991_RNA/DNA", "vonAhsen2001"),
userset = NULL,
Na = 50,
K = 0,
Tris = 0,
Mg = 0,
dNTPs = 0,
salt_method = c("Schildkraut2010", "Wetmur1991", "SantaLucia1996", "SantaLucia1998-1",
"SantaLucia1998-2", "Owczarzy2004", "Owczarzy2008", "none"),
DMSO = 0,
formamide_unit = list(value = 0, unit = "percent"),
dmso_factor = 0.75,
formamide_factor = 0.65,
mismatch = TRUE,
regions = NULL,
window = NULL,
slide = window,
unit = c("segment", "region"),
segment_size = 5e+07,
BPPARAM = NULL,
keep_sequence = NULL,
tmpdir = tempdir(),
verbose = FALSE
)
Arguments
input_seq |
Where the sequence comes from. One of:
Also accepted, and unchanged from earlier versions: a character vector of
coordinate strings |
method |
Method(s) to use for Tm calculation. Can be one or more of: - "tm_nn": Nearest Neighbor thermodynamics (default) - "tm_gc": GC content-based method - "tm_wallace": Wallace rule Default: c("tm_nn", "tm_gc", "tm_wallace") |
complement_seq |
Complementary sequence(s) in 3' to 5' direction. If not provided, the function will automatically generate it from input_seq. This is the template/target sequence that the input sequence will hybridize with. Can be provided as input_seq format besides A NULL value(default) |
ambiguous |
Logical. If TRUE, ambiguous bases are taken into account when computing the G and C content. The function handles various ambiguous bases (S, W, M, K, R, Y, V, H, D, B) by proportionally distributing their contribution to GC content based on their possible nucleotide compositions. Default: FALSE |
shift |
Integer value controlling the alignment offset between primer and template sequences. Only applicable for the NN method. Default: 0 |
nn_table |
Thermodynamic nearest-neighbor parameters for different nucleic acid hybridizations.
Only applicable for the NN method. Sets whose name encodes a sodium
concentration were fitted at that condition and are not salt-corrected
again. See Alternatively, supply a matrix or data.frame of parameters directly. This is the route for parameter sets the package does not ship, in particular sets covering modified bases such as 5-methylcytosine. Requirements:
The supplied table is reordered to the reference key order before use, so that two tables differing only in row order give identical results. A missing key would otherwise contribute zero to the calculation instead of raising an error, which is why the full key set is required. Keys that disagree with their reverse complement produce a warning: expected for modified bases, a transposition error otherwise. Two optional attributes are honoured. |
tmm_table |
Thermodynamic parameters for terminal mismatches. Only applicable for the NN method. Default: "DNA_TMM_Bommarito_2000" |
imm_table |
Thermodynamic parameters for internal mismatches. Only applicable for the NN method. Default: "DNA_IMM_Peyret_1999" |
de_table |
Thermodynamic parameters for dangling ends. Only applicable for the NN method. Default: "DNA_DE_Bommarito_2000" |
dnac_high |
Concentration of the higher concentrated strand in nM. Only applicable for the NN method. Default: 25 |
dnac_low |
Concentration of the lower concentrated strand in nM. Only applicable for the NN method. Default: 25 |
self_comp |
Logical value indicating if the sequence is self-complementary. Only applicable for the NN method. Default: FALSE |
variant |
Empirical constants coefficient for GC method. Only applicable for the GC method. Default: "Primer3Plus" |
userset |
A vector of four coefficient values for GC method. Only applicable for the GC method. Usersets override value sets. Default: NULL |
Na |
Millimolar concentration of sodium ions. Default: 50 |
K |
Millimolar concentration of potassium ions. Default: 0 |
Tris |
Millimolar concentration of Tris buffer. Default: 0 |
Mg |
Millimolar concentration of magnesium ions. Default: 0 |
dNTPs |
Millimolar concentration of deoxynucleotide triphosphates. Default: 0 |
salt_method |
Salt correction method for Tm. Default: "Schildkraut2010"
Available options:
- "none": Disables salt correction. Also selected automatically when the
chosen With |
DMSO |
Percent DMSO concentration in the reaction mixture. Default: 0 |
formamide_unit |
Formamide concentration as 'list(value, unit)'. Default: list(value = 0, unit = "percent") - value: Numeric value of formamide concentration - unit: Either "percent" or "molar" |
dmso_factor |
Coefficient of Tm decreases per percent DMSO. Default: 0.75 Other published values are 0.5, 0.6 and 0.675. |
formamide_factor |
Tm decrease per percent formamide. Default: 0.65 Several papers report factors between 0.6 and 0.72. |
mismatch |
Logical. If TRUE, every '.' in the sequence is counted as a mismatch. Only applicable for the GC method. Default: TRUE |
regions |
What to take from The identifier before the colon is resolved against whatever names the
source itself offers, and falls back to position. So |
window |
Window width in base pairs. |
slide |
Step between window starts, defaulting to |
unit |
How regions become tasks: |
segment_size |
Task size in base pairs when |
BPPARAM |
A |
keep_sequence |
Keep the |
tmpdir |
Directory for the temporary FASTA file written when
sequences are supplied directly and there is tiling or parallelism to
do. Worth setting on a cluster, where |
verbose |
Report the task and window counts. |
Details
The input sequence is processed once and passed to the selected method, which is faster than calling the individual functions separately.
The three methods differ in resolution and in the range of sequence lengths over which they are calibrated, so they are not interchangeable.
tm_nn is the appropriate default. Because it sums sequence-dependent
stacking terms, it distinguishes sequences of identical GC content but
different base order, which the other two cannot. Its parameters were derived
from short duplexes under a two-state assumption; when applied to long
sequences or to fixed-width genomic windows the resulting value is best read
as a relative measure of local thermodynamic stability for comparison across
windows, rather than as an absolute experimental melting temperature.
tm_gc computes Tm from GC percentage using one of several published
empirical formulas selected by variant, with corrections for length
and ionic strength. It extends to longer sequences at low computational cost
but cannot resolve base order.
tm_wallace applies the 2 + 4 rule, adding 2 ^{\circ}C per A or T
and 4 ^{\circ}C per G or C. It is calibrated for short oligonucleotides,
typically 14 to 20 bp, and takes no account of sequence context, salt or
chemical additives. Accuracy degrades quickly with length, so it is retained
for compatibility rather than recommended for genome-scale work.
Salt and chemical corrections apply to tm_nn and tm_gc only.
The input sequence is parsed and validated once and reused by the selected
method, which is faster than calling the individual functions directly.
Value
A TmCalculator list with:
gr |
The input |
options |
Calculation parameters and method information. For
the nearest-neighbor method this includes |
Salt handling
Most nearest-neighbor parameter sets were fitted at a single reference sodium
concentration, and other conditions are reached through the
salt_method correction formulas. The Weber/VarGibbs sets were instead
fitted directly at a stated sodium concentration and are meant to replace
salt correction. When such a set is selected and Na matches the
concentration it was fitted at, correction is skipped automatically; when it
does not, correction is applied with a warning. See tm_nn for
details.
Available Options
Method Selection:
-
method: c("tm_nn", "tm_gc", "tm_wallace")
Nearest Neighbor (NN) Method Options:
-
nn_table:DNA/DNA: "DNA_NN_Breslauer_1986", "DNA_NN_Sugimoto_1996", "DNA_NN_Allawi_1998", "DNA_NN_SantaLucia_2004" (default)
DNA/DNA, molecular crowding: "DNA_NN_Ghosh_2020_PEG200" (40 wt
DNA/DNA, salt-optimized: "DNA_NN_Weber_2015" (1020 mM), "DNA_NN_Weber_OW04_69", "..._119", "..._220", "..._621", "..._1020" (fitted at 69 to 1020 mM sodium)
RNA/RNA: "RNA_NN_Freier_1986", "RNA_NN_Xia_1998", "RNA_NN_Chen_2012", "RNA_NN_Zuber_2022" (improved end effects), "RNA_NN_Ghosh_2023_PEG200" (molecular crowding, cell-like)
RNA/RNA, salt-optimized: "RNA_NN_Weber_VIF_71", "..._121", "..._221", "..._621", "..._1021" and the corresponding "RNA_NN_Weber_FIF_*" sets
RNA/DNA: "RNA_DNA_NN_Sugimoto_1995", "RNA_DNA_NN_Weber_2019_FT", "RNA_DNA_NN_Weber_2019_VH" (1000 mM), "RNA_DNA_NN_Weber_2019_LS" (100 mM), "RNA_DNA_NN_Banerjee_2020" (100 mM)
-
tmm_table(Terminal Mismatches):"DNA_TMM_Bommarito_2000" (default)
-
imm_table(Internal Mismatches):"DNA_IMM_Peyret_1999" (default)
-
de_table(Dangling Ends):"DNA_DE_Bommarito_2000" (default)
"RNA_DE_Turner_2010"
GC Method Options:
-
variant:"Primer3Plus" (default)
"Chester1993"
"QuikChange"
"Schildkraut1965"
"Wetmur1991_MELTING"
"Wetmur1991_RNA"
"Wetmur1991_RNA/DNA"
"vonAhsen2001"
Salt Correction Options:
-
salt_method:"Schildkraut2010" (default)
"Wetmur1991"
"SantaLucia1996"
"SantaLucia1998-1"
"SantaLucia1998-2" (
method = "tm_nn"only)"Owczarzy2004" (
method = "tm_nn"only)"Owczarzy2008" (
method = "tm_nn"only)"none" (also selected automatically when
nn_tablewas fitted at the requestedNa)
With method = "tm_gc" the salt term belongs to the published formula
selected by variant, so naming a different one is ignored there, with
a warning, unless userset is supplied. "none" and NA
drop the correction and are honoured on either path.
Formamide Unit Options:
-
formamide_unit$unit:"percent" (default)
"molar"
Other Parameters:
-
ambiguous: TRUE/FALSE (default: FALSE) -
shift: Integer value (default: 0) -
dnac_high: Numeric value in nM (default: 25) -
dnac_low: Numeric value in nM (default: 25) -
self_comp: TRUE/FALSE (default: FALSE) -
Na: Millimolar concentration (default: 50) -
K: Millimolar concentration (default: 0) -
Tris: Millimolar concentration (default: 0) -
Mg: Millimolar concentration (default: 0) -
dNTPs: Millimolar concentration (default: 0) -
DMSO: Percent concentration (default: 0) -
dmso_factor: Numeric value (default: 0.75) -
formamide_factor: Numeric value (default: 0.65) -
mismatch: TRUE/FALSE (default: TRUE)
Author(s)
Junhui Li
See Also
tm_nn for the nearest-neighbor method and the full
list of thermodynamic parameter sets.
Examples
## Not run:
input_seq <- c("chr1:1000100-1000150:+:BSgenome.Hsapiens.UCSC.hg38")
result <- tm_calculate(
input_seq,
method = "tm_nn",
nn_table = "DNA_NN_SantaLucia_2004",
salt_method = "Owczarzy2008"
)
# A hybrid parameter set fitted at 100 mM sodium. Salt correction is
# skipped automatically because Na matches the fitted condition.
result_ls <- tm_calculate(
input_seq,
method = "tm_nn",
nn_table = "RNA_DNA_NN_Weber_2019_LS",
Na = 100
)
# Genome scale. The source is named rather than loaded, because each
# worker opens it for itself; `regions` says what to cover and `window`
# says at what resolution.
hg38 <- "BSgenome.Hsapiens.UCSC.hg38"
tm_calculate(hg38, regions = "chr21:10e6-20e6", window = 200, slide = 200)
# Five processes. Tasks are divided by region, never by splitting the
# sequences of one region, so only coordinates cross between them.
library(BiocParallel)
whole <- tm_calculate(hg38, window = 200, slide = 200,
BPPARAM = SnowParam(workers = 5))
whole$gr
# The same, for a FASTA file and for sequences already in R. With
# window = NULL, the default, each record returns a single Tm, which is
# what a file of probes or primers calls for.
tm_calculate("probes.fa", BPPARAM = SnowParam(workers = 4))
tm_calculate(c("ACGTGCTAGCTAGCTAGC", "GGCCATATATGCGC"))
## End(Not run)
Calculate the melting temperature using empirical formulas based on GC content
Description
Calculate the melting temperature using empirical formulas based on GC content with different options. The function returns a list of sequences with updated Tm attributes and calculation options.
Usage
tm_gc(
gr_seq,
ambiguous = FALSE,
userset = NULL,
variant = c("Primer3Plus", "Chester1993", "QuikChange", "Schildkraut1965",
"Wetmur1991_MELTING", "Wetmur1991_RNA", "Wetmur1991_RNA/DNA", "vonAhsen2001"),
Na = 50,
K = 0,
Tris = 0,
Mg = 0,
dNTPs = 0,
salt_method = NULL,
mismatch = TRUE,
DMSO = 0,
formamide_unit = list(value = 0, unit = "percent"),
dmso_factor = 0.75,
formamide_factor = 0.65
)
Arguments
gr_seq |
Sequence(s) in 5' to 3' direction, as the |
ambiguous |
Logical. If TRUE, ambiguous bases are taken into account when computing the G and C content. The function handles various ambiguous bases (S, W, M, K, R, Y, V, H, D, B) by proportionally distributing their contribution to GC content based on their possible nucleotide compositions. |
userset |
A vector of four coefficient values. Usersets override value sets. |
variant |
Empirical constants coefficient with 8 variants: - Chester1993: Tm = 69.3 + 0.41(Percentage_GC) - 650/N - QuikChange: Tm = 81.5 + 0.41(Percentage_GC) - 675/N - Percentage_mismatch - Schildkraut1965: Tm = 81.5 + 0.41( - Wetmur1991_MELTING: Tm = 81.5 + 0.41( - Wetmur1991_RNA: Tm = 78 + 0.7( - Wetmur1991_RNA/DNA: Tm = 67 + 0.8( - Primer3Plus: Tm = 81.5 + 0.41( - vonAhsen2001: Tm = 77.1 + 0.41( Salt correction is applied only for variants that include it in the formula
(via |
Na |
Millimolar concentration of sodium ions. Default: 50 |
K |
Millimolar concentration of potassium ions. Default: 0 |
Tris |
Millimolar concentration of Tris buffer. Default: 0 |
Mg |
Millimolar concentration of magnesium ions. Default: 0 |
dNTPs |
Millimolar concentration of deoxynucleotide triphosphates. Default: 0 |
salt_method |
Salt correction method:
- With a built-in "SantaLucia1998-2", "Owczarzy2004" and "Owczarzy2008" are not available
for this function. The first corrects the entropy of a nearest-neighbor
model, which a GC-content formula does not have. The other two correct
the reciprocal of the melting temperature in kelvin, referenced to the
same duplex in 1 M Na+, and carry a duplex-length term of their own,
which these formulas already have. All three are available in
|
mismatch |
Logical. If TRUE (default), every 'X' in the sequence is counted as a mismatch |
DMSO |
Percent DMSO concentration in the reaction mixture. Default: 0 |
formamide_unit |
Formamide concentration as 'list(value, unit)'. Default: list(value = 0, unit = "percent") - value: Numeric value of formamide concentration - unit: Either "percent" or "molar" |
dmso_factor |
Coefficient of Tm decreases per percent DMSO. Default: 0.75 (von Ahsen et al. 2001) Other published values are 0.5, 0.6 and 0.675. |
formamide_factor |
Coefficient of Tm decrease per percent formamide. Default: 0.65 Several papers report factors between 0.6 and 0.72. |
Value
Returns a list with two components: - Tm: A list of sequences with updated Tm attributes - Options: A list containing calculation parameters and method information
Author(s)
Junhui Li
References
Marmur J, Doty P. Determination of the base composition of deoxyribonucleic acid from its thermal denaturation temperature. Journal of Molecular Biology, 1962, 5(1):109-118.
Schildkraut C, Lifson S. Dependence of the melting temperature of DNA on salt concentration. Biopolymers, 1965, 3(2):195-208.
Wetmur JG. DNA Probes: Applications of the Principles of Nucleic Acid Hybridization. CRC Critical Reviews in Biochemistry, 1991, 26(3-4):33.
Untergasser A, Cutcutache I, Koressaar T, et al. Primer3–new capabilities and interfaces. Nucleic Acids Research, 2012, 40(15):e115-e115.
von Ahsen N, Wittwer CT, Schutz E, et al. Oligonucleotide melting temperatures under PCR conditions: deoxynucleotide Triphosphate and Dimethyl sulfoxide concentrations with comparison to alternative empirical formulas. Clin Chem 2001, 47:1956-1961.
Examples
# Example with multiple sequences
input_seq <- c("ATCGTGCGTAGCAGTACGATCAGTAG", "ATCGTGCGTAGCAGTACGATCAGTAG")
gr_seq <- to_genomic_ranges(input_seq)
out <- tm_gc(gr_seq, ambiguous = TRUE, variant = "Primer3Plus", Na = 50, mismatch = TRUE)
out
out$options
Calculate melting temperature using nearest neighbor thermodynamics
Description
Calculates melting temperature (Tm) from nearest-neighbor (NN) thermodynamics, summing the stacking enthalpies and entropies of adjacent base-pair steps and applying initiation, symmetry, salt and chemical corrections. Terminal mismatches, internal mismatches and dangling ends are supported through dedicated parameter tables. The function verifies that every dinucleotide step in the input sequence is present in the selected tables before calculating.
Usage
tm_nn(
gr_seq,
ambiguous = FALSE,
shift = 0,
nn_table = c("DNA_NN_SantaLucia_2004", "DNA_NN_Ghosh_2020_PEG200",
"DNA_NN_Breslauer_1986", "DNA_NN_Sugimoto_1996", "DNA_NN_Allawi_1998",
"RNA_NN_Freier_1986", "RNA_NN_Xia_1998", "RNA_NN_Chen_2012", "RNA_NN_Zuber_2022",
"RNA_NN_Ghosh_2023_PEG200", "RNA_DNA_NN_Sugimoto_1995", "DNA_NN_Weber_2015",
"DNA_NN_Weber_OW04_69", "DNA_NN_Weber_OW04_119", "DNA_NN_Weber_OW04_220",
"DNA_NN_Weber_OW04_621", "DNA_NN_Weber_OW04_1020", "RNA_NN_Weber_VIF_71",
"RNA_NN_Weber_VIF_121", "RNA_NN_Weber_VIF_221", "RNA_NN_Weber_VIF_621",
"RNA_NN_Weber_VIF_1021", "RNA_NN_Weber_FIF_71", "RNA_NN_Weber_FIF_121",
"RNA_NN_Weber_FIF_221", "RNA_NN_Weber_FIF_621", "RNA_NN_Weber_FIF_1021",
"RNA_DNA_NN_Weber_2019_FT", "RNA_DNA_NN_Weber_2019_VH", "RNA_DNA_NN_Weber_2019_LS",
"RNA_DNA_NN_Banerjee_2020"),
tmm_table = "DNA_TMM_Bommarito_2000",
imm_table = "DNA_IMM_Peyret_1999",
de_table = c("DNA_DE_Bommarito_2000", "RNA_DE_Turner_2010"),
dnac_high = 25,
dnac_low = 25,
self_comp = FALSE,
Na = 50,
K = 0,
Tris = 0,
Mg = 0,
dNTPs = 0,
salt_method = c("Schildkraut2010", "Wetmur1991", "SantaLucia1996", "SantaLucia1998-1",
"SantaLucia1998-2", "Owczarzy2004", "Owczarzy2008", "none"),
DMSO = 0,
formamide_unit = list(value = 0, unit = "percent"),
dmso_factor = 0.75,
formamide_factor = 0.65
)
Arguments
gr_seq |
Sequence(s) in 5' to 3' direction, as the |
ambiguous |
Logical value controlling how ambiguous bases are handled: - TRUE: Ambiguous bases (e.g., N, R, Y) are included in calculations - FALSE (default): Ambiguous bases are excluded from calculations |
shift |
Integer value controlling the alignment offset between primer and template sequences. Visual representation of different shift values: shift = 0 (default): Primer: 5' ATGCG 3' Template: 3' TACGC 5' shift = -1: Primer: 5' ATGCG 3' Template: 3' TACGC 5' ^ shift = 1: Primer: 5' ATGCG 3' Template: 3' TACGC 5' ^ The shift parameter is necessary when: - Sequences have different lengths - Dangling ends are required - Specific alignment positions are needed |
nn_table |
Thermodynamic nearest-neighbor parameters for different nucleic acid hybridizations. Parameter sets are listed below by hybridization type. Sets marked with a sodium concentration were fitted at that condition and are not salt-corrected further (see the "Choosing a parameter set" section). DNA/DNA hybridizations, reference salt: - "DNA_NN_Breslauer_1986": Original DNA/DNA parameters - "DNA_NN_Sugimoto_1996": Improved DNA/DNA parameters - "DNA_NN_Allawi_1998": Watson-Crick parameters from Allawi & SantaLucia (1997), Table 1; the historical identifier is retained for compatibility - "DNA_NN_SantaLucia_2004": Unified DNA/DNA parameters (default) DNA/DNA hybridizations, melting-temperature optimized (Weber 2015): - "DNA_NN_Weber_2015": Combined dataset, 1020 mM. Recommended when a salt-optimized DNA set is wanted at high salt - "DNA_NN_Weber_OW04_69", "...119", "...220", "...621", "...1020": fitted independently at 69, 119, 220, 621 and 1020 mM sodium DNA/DNA under molecular crowding (cell-like rather than dilute solution): - "DNA_NN_Ghosh_2020_PEG200": fitted in 40 wt RNA/RNA hybridizations, reference salt: - "RNA_NN_Freier_1986": Original RNA/RNA parameters - "RNA_NN_Xia_1998": Improved RNA/RNA parameters - "RNA_NN_Chen_2012": Updated RNA/RNA parameters with GU pair corrections - "RNA_NN_Zuber_2022": Successor to Xia 1998 with improved end effects. The terminal-AU penalty is replaced by end terms that depend on the penultimate base pair, applied automatically from a companion table RNA/RNA under molecular crowding (cell-like rather than dilute solution): - "RNA_NN_Ghosh_2023_PEG200": fitted in 40 wt and shown to describe duplexes in an intracellular cation composition RNA/RNA hybridizations, salt-optimized (Ferreira 2019). VIF (variable initiation factors) gave better cross-validation than FIF (fixed): - "RNA_NN_Weber_VIF_71", "...121", "...221", "...621", "...1021" - "RNA_NN_Weber_FIF_71", "...121", "...221", "...621", "...1021" RNA/DNA hybridizations: - "RNA_DNA_NN_Sugimoto_1995": RNA/DNA hybridization parameters - "RNA_DNA_NN_Weber_2019_FT": curve-fitting derived, 1000 mM. Best performing high-salt hybrid set in Basilio Barbosa (2019) - "RNA_DNA_NN_Weber_2019_VH": van't Hoff derived, 1000 mM - "RNA_DNA_NN_Weber_2019_LS": low salt, 100 mM - "RNA_DNA_NN_Banerjee_2020": improved hybrid parameters fitted at a physiological condition (100 mM NaCl), Banerjee et al. (2020) For every hybrid set the sequence you supply must be the RNA
strand, written 5' to 3' and spelled with T in place of U; its complement
is then the DNA strand, read 3' to 5'. The published keys are indexed the
same way, RNA on top: Alternatively, supply a matrix or data.frame of parameters directly. This is the route for parameter sets the package does not ship, in particular sets covering modified bases such as 5-methylcytosine. Requirements:
The supplied table is reordered to the reference key order before use, so that two tables differing only in row order give identical results. A missing key would otherwise contribute zero to the calculation instead of raising an error, which is why the full key set is required. Keys that disagree with their reverse complement produce a warning: expected for modified bases, a transposition error otherwise. Two optional attributes are honoured. |
tmm_table |
Thermodynamic parameters for terminal mismatches. Default: "DNA_TMM_Bommarito_2000" These 48 parameters come from SantaLucia & Peyret (2001), patent WO2001094611A2, Tables 2-3. The historical identifier is retained; Bommarito (2000) is the source of DNA dangling ends, not this table. |
imm_table |
Thermodynamic parameters for internal mismatches. Default: "DNA_IMM_Peyret_1999" This is a composite of six publications (1997-2005), not a single Peyret (1999) table: 11 G.T, 8 G.A, 8 A.C, 8 C.T, 16 like-with-like mismatches and 36 inosine entries. The A.C parameters are for pH 7. |
de_table |
Thermodynamic parameters for dangling ends. Default: "DNA_DE_Bommarito_2000" Available options: - "DNA_DE_Bommarito_2000": Parameters for DNA dangling ends - "RNA_DE_Turner_2010": NNDB Turner 2004 RNA dangling-end compilation; 2010 is the database publication year. Entropies are derived from tabulated enthalpies and free energies at 37 degrees C |
dnac_high |
Concentration of the higher concentrated strand in nM. Default: 25 Typically this is the primer (for PCR) or the probe concentration. |
dnac_low |
Concentration of the lower concentrated strand in nM. Default: 25 This is typically the template concentration. |
self_comp |
Logical value indicating if the sequence is self-complementary: - TRUE: Sequence can bind to itself, dnac_low is ignored - FALSE (default): Sequence binds to a different complementary sequence |
Na |
Millimolar concentration of sodium ions. Default: 50 |
K |
Millimolar concentration of potassium ions. Default: 0 |
Tris |
Millimolar concentration of Tris buffer. Default: 0 |
Mg |
Millimolar concentration of magnesium ions. Default: 0 |
dNTPs |
Millimolar concentration of deoxynucleotide triphosphates. Default: 0 |
salt_method |
Salt correction method. Options are:
Available options:
- "Schildkraut2010": Schildkraut & Lifson (1965); historical identifier
- "Wetmur1991": Classic salt correction method
- "SantaLucia1996": DNA-specific salt correction
- "SantaLucia1998-1": Improved DNA salt correction, applied to Tm
- "SantaLucia1998-2": the same correction applied to the entropy of the
nearest-neighbor model rather than to Tm, which is why it is available
here and not in |
DMSO |
Percent DMSO concentration in the reaction mixture. Default: 0 DMSO can lower the melting temperature of nucleic acid duplexes. |
formamide_unit |
Formamide concentration as 'list(value, unit)'. Default: list(value = 0, unit = "percent") - value: numeric value of formamide concentration - unit: character string specifying the unit ("percent" or "molar") Default: list(value=0, unit="percent") |
dmso_factor |
Coefficient of melting temperature (Tm) decrease per percent DMSO. Default: 0.75 (von Ahsen N, 2001, PMID:11673362) Other accepted empirical coefficients: 0.5, 0.6, 0.65, 0.675 |
formamide_factor |
Coefficient of melting temperature (Tm) decrease per percent formamide. Default: 0.65, an empirical convention. Accepted alternatives are 0.6 and 0.72; these are not all estimates from the same publication. The molar formula instead follows Blake & Delcourt (1996). |
Details
DNA_NN_Breslauer_1986: Breslauer K J (1986) <doi:10.1073/pnas.83.11.3746>
DNA_NN_Sugimoto_1996: Sugimoto N (1996) <doi:10.1093/nar/24.22.4501>
DNA_NN_Allawi_1998: Allawi H T & SantaLucia J Jr (1997), Table 1 <doi:10.1021/bi962590c>; also SantaLucia (1998), Table 2 <doi:10.1073/pnas.95.4.1460>
DNA_NN_SantaLucia_2004: SantaLucia J (2004) <doi:10.1146/annurev.biophys.32.110601.141800>
RNA_NN_Freier_1986: Freier S (1986) <doi:10.1073/pnas.83.24.9373>
RNA_NN_Xia_1998: Xia T (1998) <doi:10.1021/bi9809425>
RNA_NN_Chen_2012: Chen JL (2012) <doi:10.1021/bi3002709>
RNA_DNA_NN_Sugimoto_1995: Sugimoto N (1995)<doi:10.1021/bi00035a029>
The following sets were derived by melting-temperature optimization and are fitted at the sodium concentration given in parentheses. They are not salt-corrected further; see the “Choosing a parameter set” section.
DNA_NN_Weber_2015 (1020 mM): Weber G (2015) <doi:10.1093/bioinformatics/btu751>
DNA_NN_Weber_OW04_69 (69 mM), DNA_NN_Weber_OW04_119 (119 mM), DNA_NN_Weber_OW04_220 (220 mM), DNA_NN_Weber_OW04_621 (621 mM), DNA_NN_Weber_OW04_1020 (1020 mM): Weber G (2015) <doi:10.1093/bioinformatics/btu751>
RNA_NN_Weber_VIF_71 (71 mM), RNA_NN_Weber_VIF_121 (121 mM), RNA_NN_Weber_VIF_221 (221 mM), RNA_NN_Weber_VIF_621 (621 mM), RNA_NN_Weber_VIF_1021 (1021 mM): Ferreira I (2019) <doi:10.1016/j.chemphys.2019.01.016>, variable initiation factors
RNA_NN_Weber_FIF_71 (71 mM), RNA_NN_Weber_FIF_121 (121 mM), RNA_NN_Weber_FIF_221 (221 mM), RNA_NN_Weber_FIF_621 (621 mM), RNA_NN_Weber_FIF_1021 (1021 mM): Ferreira I (2019) <doi:10.1016/j.chemphys.2019.01.016>, fixed initiation factors
RNA_DNA_NN_Weber_2019_FT (1000 mM), RNA_DNA_NN_Weber_2019_VH (1000 mM), RNA_DNA_NN_Weber_2019_LS (100 mM): Basilio Barbosa V (2019) <doi:10.1016/j.bpc.2019.106189>
RNA_DNA_NN_Banerjee_2020 (100 mM): Banerjee D (2020) <doi:10.1093/nar/gkaa572>
RNA_NN_Zuber_2022: Zuber J (2022) <doi:10.1093/nar/gkac261>
RNA_NN_Ghosh_2023_PEG200 (100 mM, 40 wt
DNA_NN_Ghosh_2020_PEG200 (100 mM, 40 wt
DNA_TMM_Bommarito_2000: SantaLucia J Jr & Peyret N (2001), WO2001094611A2, Tables 2-3 (https://patents.google.com/patent/WO2001094611A2/en)
DNA_IMM_Peyret_1999: Allawi H T & SantaLucia J Jr (1997, G.T) <doi:10.1021/bi962590c>; (1998, G.A) <doi:10.1021/bi9724873>; (1998, A.C) <doi:10.1021/bi9803729>; (1998, C.T) <doi:10.1093/nar/26.11.2694>; Peyret N et al. (1999, A.A/C.C/G.G/T.T) <doi:10.1021/bi9825091>; Watkins N E Jr & SantaLucia J Jr (2005, inosine) <doi:10.1093/nar/gki918>
DNA_DE_Bommarito_2000: Bommarito S (2000) <doi:10.1093/nar/28.9.1929>
RNA_DE_Turner_2010: NNDB Turner 2004 dangling-end compilation; Turner D H & Mathews D H (2010, database description) <doi:10.1093/nar/gkp892>
Value
A TmCalculator list with:
gr |
The input |
options |
The calculation parameters actually used, including
the parameter tables and their citations, ion and additive
concentrations, |
Choosing a parameter set
Parameter sets fall into two families that are handled differently.
The two families are distinguished by one mechanical criterion: a set is
condition-specific if and only if it carries a salt_mM attribute.
Reference-salt sets (no salt_mM; Breslauer 1986,
Sugimoto 1996, Allawi 1997 (legacy name: Allawi_1998), SantaLucia 2004, Freier 1986, Xia 1998,
Chen 2012, Zuber 2022, Sugimoto 1995) were fitted at a single reference
sodium concentration, and other conditions are reached by applying one of
the salt_method correction formulas.
Condition-specific sets (the Weber/VarGibbs series, Banerjee 2020,
and the molecular-crowding sets of Ghosh 2020 and Ghosh 2023) were instead
fitted directly at a stated sodium concentration and are intended to
replace salt correction rather than be corrected. When the requested
Na matches the set's salt_mM value,
salt correction is skipped automatically; when it does not, the correction is
still applied but a warning is issued, since correcting an already
condition-specific set double-counts the ionic effect. Whether a correction
was applied is recorded in the returned options.
As a rule of thumb, pick the set whose fitted salt is closest to your experimental condition rather than correcting a distant one.
What the initiation terms are charged on
A dangling end or a terminal mismatch is accounted for by its own parameter,
from de_table or tmm_table, and the position it covers is then
consumed. The initiation terms – init, init_A/T,
init_G/C, init_5T/A and the init_allA/T /
init_oneG/C pair – are charged on what remains, that is, on the
duplex that actually closes.
This matters because the terminal AT penalty is a property of the closing base pair. SantaLucia and Hicks (2004) define it as applied for each end of a duplex that has a terminal AT, so the question it asks is whether the pair holding that end shut is AT or GC. A mismatched terminus is neither an AT nor a GC pair, and a dangling residue is not in a base pair at all, so neither one can carry the penalty. Charging it there would also double-count the end, since the terminal-mismatch and dangling-end parameters were measured as terminal and already carry that end's contribution.
Some implementations index these terms on the sequence as supplied rather
than on the trimmed duplex. That makes the melting temperature depend on
which of the two strands is handed over as gr_seq: the same duplex,
written from the other strand, can then come back with a different answer.
The convention here is invariant under that swap by construction. See the
1.1.2 entry in NEWS for a worked example.
Parameter provenance and limitations
Table identifiers are retained for compatibility and are not always literal
author-year citations. The installed files
extdata/tm_nn_reference_audit.md and
extdata/tm_nn_parameter_sources.tsv record the source and verification
status of every built-in parameter row.
The audit identified unresolved numerical/model issues: the patent's
GG/CG terminal-mismatch enthalpy is inconsistent with its printed
free energy; RNA_NN_Chen_2012 combines refitted Watson-Crick terms
with GU terms fitted against Xia (1998); and Banerjee (2020) initiation
conditions in Table 2 footnotes are not reproduced by the current per-end
application. The audit corrects citations without changing these numerical
results. Consult the audit before using these affected models.
Author(s)
Junhui Li
References
Breslauer KJ, Frank R, Blocker H, Marky LA (1986). Predicting DNA duplex stability from the base sequence. PNAS 83:3746-3750. <doi:10.1073/pnas.83.11.3746>
Sugimoto N, Nakano S, Yoneyama M, Honda K (1996). Improved thermodynamic parameters and helix initiation factor to predict stability of DNA duplexes. NAR 24:4501-4505. <doi:10.1093/nar/24.22.4501>
Allawi HT, SantaLucia J Jr (1997). Thermodynamics and NMR of internal G.T mismatches in DNA. Biochemistry 36:10581-10594. Table 1: Watson-Crick parameters; Table 5: G.T mismatches. <doi:10.1021/bi962590c>
SantaLucia J Jr (1998). A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. PNAS 95:1460-1465. <doi:10.1073/pnas.95.4.1460>
SantaLucia J Jr, Hicks D (2004). The thermodynamics of DNA structural motifs. Annual Review of Biophysics and Biomolecular Structure 33:415-440. <doi:10.1146/annurev.biophys.32.110601.141800>
Freier SM et al. (1986). Improved free-energy parameters for predictions of RNA duplex stability. PNAS 83:9373-9377. <doi:10.1073/pnas.83.24.9373>
Xia T et al. (1998). Thermodynamic parameters for an expanded nearest-neighbor model for formation of RNA duplexes with Watson-Crick base pairs. Biochemistry 37:14719-14735. <doi:10.1021/bi9809425>
Chen JL et al. (2012). Testing the nearest neighbor model for canonical RNA base pairs: revision of GU parameters. Biochemistry 51:3508-3522. <doi:10.1021/bi3002709>
Sugimoto N et al. (1995). Thermodynamic parameters to predict stability of RNA/DNA hybrid duplexes. Biochemistry 34:11211-11216. <doi:10.1021/bi00035a029>
Allawi HT, SantaLucia J Jr (1998). Nearest-neighbor thermodynamics of internal A.C mismatches in DNA: sequence dependence and pH effects. Biochemistry 37:9435-9444. <doi:10.1021/bi9803729>
Allawi HT, SantaLucia J Jr (1998). Nearest neighbor thermodynamic parameters for internal G.A mismatches in DNA. Biochemistry 37:2170-2179. <doi:10.1021/bi9724873>
Allawi HT, SantaLucia J Jr (1998). Thermodynamics of internal C.T mismatches in DNA. NAR 26:2694-2701. <doi:10.1093/nar/26.11.2694>
Peyret N, Seneviratne PA, Allawi HT, SantaLucia J Jr (1999). Nearest-neighbor thermodynamics and NMR of DNA sequences with internal A.A, C.C, G.G, and T.T mismatches. Biochemistry 38:3468-3477. <doi:10.1021/bi9825091>
Watkins NE Jr, SantaLucia J Jr (2005). Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes. NAR 33:6258-6267. <doi:10.1093/nar/gki918>
SantaLucia J Jr, Peyret N (2001). Method and system for predicting nucleic acid hybridization thermodynamics and computer-readable storage medium for use therein. Patent WO2001094611A2, published December 13, 2001, Tables 2-3. https://patents.google.com/patent/WO2001094611A2/en
Bommarito S, Peyret N, SantaLucia J Jr (2000). Thermodynamic parameters for DNA sequences with dangling ends. NAR 28:1929-1934. <doi:10.1093/nar/28.9.1929>
Turner DH, Mathews DH (2010). NNDB: the nearest neighbor parameter database for predicting stability of nucleic acid secondary structure. NAR 38:D280-D282. <doi:10.1093/nar/gkp892> The RNA dangling-end values are the Turner 2004 compilation: https://rna.urmc.rochester.edu/NNDB/rna_2004/rna_2004_dangling_ends.html
Weber G (2015). Optimization method for obtaining nearest-neighbour DNA entropies and enthalpies directly from melting temperatures. Bioinformatics 31:871-877. <doi:10.1093/bioinformatics/btu751>
Ferreira I, Jolley EA, Znosko BM, Weber G (2019). Replacing salt correction factors with optimized RNA nearest-neighbour enthalpy and entropy parameters. Chemical Physics 521:69-76. <doi:10.1016/j.chemphys.2019.01.016>
Basilio Barbosa V, de Oliveira Martins E, Weber G (2019). Nearest-neighbour parameters optimized for melting temperature prediction of DNA/RNA hybrids at high and low salt concentrations. Biophysical Chemistry 251:106189. <doi:10.1016/j.bpc.2019.106189>
Banerjee D et al. (2020). Improved nearest-neighbor parameters for the stability of RNA/DNA hybrids under a physiological condition. NAR 48:12042-12054. <doi:10.1093/nar/gkaa572>
Zuber J, Schroeder SJ, Sun H, Turner DH, Mathews DH (2022). Nearest neighbor rules for RNA helix folding thermodynamics: improved end effects. NAR 50:5251-5262. <doi:10.1093/nar/gkac261>
Ghosh S et al. (2020). Nearest-neighbor parameters for predicting DNA duplex stability in diverse molecular crowding conditions. PNAS 117:14194-14201. <doi:10.1073/pnas.1920886117>
Ghosh S et al. (2023). Nearest-neighbor parameters for the prediction of RNA duplex stability in diverse in vitro and cellular-like crowding conditions. NAR 51:4101-4111. <doi:10.1093/nar/gkad020>
Blake RD, Delcourt SG (1996). Thermodynamic effects of formamide on DNA stability. NAR 24:2095-2103. <doi:10.1093/nar/24.11.2095>
See Also
tm_calculate for a single entry point to the
nearest-neighbor, GC-content and Wallace methods.
Examples
input_seq <- c("AAAATTTTTTTCCCCCCCCCCCCCCGGGGGGGGGGGGTGTGCGCTGC",
"AAAATTTTTTTCCCCCCCCCCCCCCGGGGGGGGGGGGTGTGCGCTGC")
seqs <- to_genomic_ranges(input_seq)
out <- tm_nn(seqs, Na=50)
out
# A parameter set fitted at a stated sodium concentration. Because Na
# matches the concentration the set was fitted at, salt correction is
# skipped automatically rather than applied on top of it.
out_ls <- tm_nn(seqs, nn_table = "RNA_DNA_NN_Weber_2019_LS", Na = 100)
out_ls$options[["Salt correction applied"]]
# -- A parameter table supplied by the user --------------------------------
# Any of nn_table, tmm_table, imm_table and de_table also accepts a matrix,
# which is how a set the package does not ship, most obviously one covering
# modified bases, is used without waiting for a new release.
#
# Start from a built-in set to get the required keys, then add a stack. The
# key naming follows the built-in convention: top strand, "/", bottom
# strand, so "MG/CG" would be a 5-methylcytosine followed by G, paired with
# CG. The values here are illustrative and are NOT measured parameters.
tbl <- TmCalculator:::get_table("DNA_NN_SantaLucia_2004")
tbl <- rbind(tbl, "MG/CG" = c(-9.1, -24.0))
# Optional attributes. "reference" names the built-in whose key set must be
# present, which matters for RNA and hybrid tables because the default
# reference is a DNA/DNA set. "salt_mM" marks the table as fitted at a
# stated sodium concentration, so that it suppresses the salt correction at
# that concentration exactly as the built-in condition-specific sets do.
attr(tbl, "reference") <- "DNA_NN_SantaLucia_2004"
out_user <- tm_nn(seqs, nn_table = tbl, Na = 50)
out_user$options[["Thermodynamic NN values"]]
# "user-supplied (reference: DNA_NN_SantaLucia_2004)"
# Passing a built-in table back in through this route changes nothing: the
# supplied table is reordered to the reference key order before use, so row
# order carries no information.
identical(tm_nn(seqs, nn_table = "DNA_NN_SantaLucia_2004")$gr$Tm,
tm_nn(seqs,
nn_table = TmCalculator:::get_table("DNA_NN_SantaLucia_2004")
)$gr$Tm)
# A table missing a key is refused rather than tolerated. The compiled core
# resolves each stack by name, so an absent key would contribute zero
# enthalpy and entropy to every sequence containing that step, silently.
try(tm_nn(seqs, nn_table = tbl[setdiff(rownames(tbl), "AA/TT"), ]))
out_ls$options[["Parameter set fitted at [Na+] (mM)"]]
Calculate the melting temperature using the 'Wallace rule'
Description
The Wallace rule is often used as rule of thumb for approximate melting temperature calculations for primers with 14 to 20 nt length.
Usage
tm_wallace(gr_seq, ambiguous = FALSE)
Arguments
gr_seq |
Sequence(s) in 5' to 3' direction, as the |
ambiguous |
Ambiguous bases are taken into account to compute the G and C content when ambiguous is TRUE. |
Value
Returns a list of sequences with updated Tm attributes
Length of validity
The 2 + 4 rule was calibrated on 14 to 20 nt hybridisation probes and carries no length-dependent, salt-dependent or concentration-dependent term. Its error therefore grows without bound as sequences lengthen, and on genome-scale windows it returns a number that is not a melting temperature in any useful sense: a 200 bp window is reported at several hundred degrees Celsius.
Sequences longer than 30 nt raise a warning that names
tm_nn as the appropriate alternative. A warning rather than
an error, because the rule stays a legitimate rule of thumb and users who
knowingly apply it outside its calibrated range should not be blocked;
wrap the call in suppressWarnings() in that case.
Author(s)
Junhui Li
References
Thein S L , Lynch J R , Weatherall D J , et al. DIRECT DETECTION OF HAEMOGLOBIN E WITH SYNTHETIC OLIGONUCLEOTIDES[J]. The Lancet, 1986, 327(8472):93.
Examples
input_seq = c('acgtTGCAATGCCGTAWSDBSY','acgtTGCCCCGGCCGCGCCGTAWSDBSY') #for wallace rule
gr_seq <- to_genomic_ranges(input_seq)
out <- tm_wallace(gr_seq, ambiguous = TRUE)
out
out$options
Convert input sequences to a GRanges object (fast backend)
Description
Drop-in replacement for to_genomic_ranges that uses the fast
coordinate backend in coor_to_genomic_ranges for genomic
coordinate input. Accepts the same input_seq and complement_seq
arguments as to_genomic_ranges, plus a list input
list(pkg_name = ..., seq = ...) for large tiling jobs.
This function processes a vector of sequences string, a FASTA file, or a character vector with genomic coordinates into a GenomicRanges object, optionally including complementary sequences. sequence names are parsed based on their format: - If names have this pattern "chr:start-end:strand:species[:name]" (e.g., "chr1:1-5:+:seq_1"), parse components into seqnames, ranges, strand, and name. - If names have this pattern "chr:start-end:strand" (e.g., "chr1:1-5:+"), parse components into seqnames, ranges, and strand. - If names have this pattern "chr:start-end" (e.g., "chr1:1-5"), parse components into seqnames and ranges. - If no names are provided, use default values: seqnames = "chr1", start = 1, width = sequence length, strand = "*", name = "1", etc. Complementary sequences are either provided or automatically generated.
Usage
to_genomic_ranges_fast(
input_seq,
complement_seq = NULL,
method = c("vectorized", "preload_chr")
)
to_genomic_ranges(input_seq, complement_seq = NULL)
Arguments
input_seq |
Input sequence(s) in 5' to 3' direction. Can be provided as either:
- A character string (e.g., c("ATGCG", "GCTAG"))
- A path to a FASTA file containing the sequence(s)
- A character vector where each element is a string in the format "chr:start-end:strand:species" #' (e.g., "chr1:100-200:+:BSgenome.Hsapiens.UCSC.hg38"). Strand is "+" for positive or "-" for negative.
- chr: Chromosome ID
- start: Start position
- end: End position
- strand: positive or negative strand
- species: Species name for reference genome (e.g., "BSgenome.Hsapiens.UCSC.hg38"), see |
complement_seq |
Optional complementary sequences, in the same formats
Supply the plain complement, aligned base for base with
input_seq 5'-G C A T C G-3' complement_seq 3'-C G T A G C-5' The reverse complement ("CGATGC" here) is the same strand written
5' to 3', which is what A complement that differs from the plain one at some positions is a mismatched duplex and is handled as such. |
method |
Sequence extraction method passed to
|
Value
A GRanges object. See coor_to_genomic_ranges for
metadata columns when coordinate input is used.
A GenomicRanges object with seqnames, ranges, strand, name, sequence, Complement, and Tm as metadata.
Author(s)
Junhui Li
Examples
## Not run:
gr <- to_genomic_ranges_fast(
list(
pkg_name = "BSgenome.Hsapiens.UCSC.hg38",
seq = c("chr1:1000-1199:+:win1", "chr1:1200-1399:+:win2")
)
)
## End(Not run)
# Using a character vector with auto-generated complementary sequences
seqs <- c("ATGCG", "GCTAG")
names(seqs) <- c("chr1:1-5:+:seq_1", "chr2:1-5:+")
gr <- to_genomic_ranges(seqs)
gr
# Using a character vector with provided complementary sequences
seqs <- c("ATGCG", "GCTAG")
comp_seqs <- c("TACGC", "CGTA")
gr <- to_genomic_ranges(seqs, comp_seqs)
gr
# Using a FASTA file
gr <- to_genomic_ranges(system.file("extdata", "example1.fasta", package = "TmCalculator"))
## Not run:
# Using a character vector with genomic coordinates
seqs <- c(
"chr1:1898000-1898050:+:BSgenome.Hsapiens.UCSC.hg38",
"chr2:2563000-2563050:-:BSgenome.Hsapiens.UCSC.hg38"
)
gr <- to_genomic_ranges(seqs)
gr
## End(Not run)
Convert sequence strings to GenomicRanges object
Description
This function converts sequence strings to a GenomicRanges object, handling both named and unnamed sequences. It can also process complementary sequences if provided. sequence names can be in the format ">chr2:1-10:+:seq2" which will be parsed into chromosome, position, strand, and name components.
Usage
vec_to_genomic_ranges(input_seq)
Arguments
input_seq |
A character vector of sequences. If named with format "chr2:1-10:[+|-]:[seq_name]" the name will be parsed into GRanges components. |
Value
A GenomicRanges object containing: - GRanges information (seqnames, ranges, strand) - sequence data - Complementary sequences - Names from input or auto-generated
Examples
# Example with named sequences in GRanges format
seqs <- c("ATGCG", "GCTAG")
names(seqs) <- c("chr1:1111-1115:+:seq1", "chr2:1221-1225:+")
gr <- vec_to_genomic_ranges(seqs)
# Example with unnamed sequences
seqs <- c("ATGCG", "GCTAG")
gr <- vec_to_genomic_ranges(seqs)