The hardware and bandwidth for this mirror is donated by METANET, the Webhosting and Full Service-Cloud Provider.
If you wish to report a bug, or if you are interested in having us mirror your free-software or open-source project, please feel free to contact us at mirror[@]metanet.ch.
The rchime() function allows you to detect and remove
chimeras from your dataset using a referenced based approach.
rchime() can be used with strollur
objects or data.frames as inputs. Let’s look at examples of both
data types using sequence data from mothur’s MiSeq_SOP example
analysis, and the silva_gold() reference sequences.
rchime is designed to be flexible and you can use any reference
you choose.
Let’s create a strollur object containing the MiSeq_SOP sequences.
fasta_data <- readRDS(rchime_example("miseq_fasta.rds"))
abundance_data <- readRDS(rchime_example("miseq_abundance.rds"))
strollur <- strollur::new_dataset("rchime reference example")
strollur::add(strollur, table = fasta_data, type = "sequence")
#> Added 6084 sequences.
strollur::assign(strollur, table = abundance_data, type = "sequence_abundance")
#> Assigned 6084 sequence abundances.
strollur
#> rchime reference example:
#>
#> starts ends nbases ambigs polymers numns numseqs
#> Minimum: 1 249 249 0 3 0 1.00
#> 2.5%-tile: 1 252 252 0 4 0 3216.38
#> 25%-tile: 1 252 252 0 4 0 32163.75
#> Median: 1 253 253 0 4 0 64327.50
#> 75%-tile: 1 253 253 0 5 0 96491.25
#> 97.5%-tile: 1 254 254 0 6 0 125438.62
#> Maximum: 1 256 256 0 8 0 128655.00
#> Mean: 1 252 252 0 4 0 64327.64
#>
#> Number of unique seqs: 6084
#> Total number of seqs: 128655
#>
#> Total number of samples: 20data_df <- readRDS(rchime_example("miseq_data_frame.rds"))
str(data_df)
#> 'data.frame': 6084 obs. of 3 variables:
#> $ sequence_name: chr "M00967_43_000000000-A3JHG_1_1101_10133_8460" "M00967_43_000000000-A3JHG_1_1101_10134_24617" "M00967_43_000000000-A3JHG_1_1101_10331_23332" "M00967_43_000000000-A3JHG_1_1101_10340_12294" ...
#> $ sequence : chr "TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGCAAGTCAGAAGTGAAAACCCGGGGCTCAACCCTGGGAGTGCTTTTGAAACT"| __truncated__ "TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGCAAGTCAGAAGTGAAAACCCGGGGCTCAACCCTGGGAGTGCTTTTGAAACT"| __truncated__ "TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGCATGGCAAGTCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGAAACT"| __truncated__ "TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGCTGTTAAGTCAGCGGTCAAATGTCGGGGCTCAACGCCGTCGAGCCGTTGAAACTG"| __truncated__ ...
#> $ abundance : int 620 4 1 1 1 1 1 3 1 2 ...When removing chimeras using a reference, the potential parents are chosen from the set of reference sequences. Let’s use the reference to remove the chimeras.
reference <- silva_gold()
str(reference)
#> 'data.frame': 5181 obs. of 2 variables:
#> $ sequence_name: chr "7000004128189528" "7000004128189537" "7000004128189547" "7000004128189554" ...
#> $ sequence : chr "GACGAACGCTGGCGGCGTGCTTAACACATGCAAGTCGAGCGGAAAGGCCCTTCGGGGTACTCGAGCGGCGAACGGGTGAGTAACACGTGGGCAACCTACCCCCAGCACCGG"| __truncated__ "GATGAACGCTGGCGGTATGCTTAACACATGCAAGTCGAACGGAATCTTCGGATTTAGTGGCGGACGGGTGAGTAACGCGTGAGAATCTAGCTCTAGGTCGGGGACAACCAC"| __truncated__ "ATTGAACGCTGGCGGCATGCCTTACACATGCAAGTCGAACGGTAACAGGTCTTCGGATGCTGACGAGTGGCGAACGGGTGAGTAATACATCGGAACGTGCCCGATCGTGGG"| __truncated__ "GATGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAACGAAGCATCTTCGGATGCTTAGTGGCGAACGGGTGAGTAACACGTAGATAACCTACCTTTAACTCGAGGATA"| __truncated__ ...
strollur_results <- rchime(strollur, reference = reference)
#> Added a chimera_report report.
#> → rchime removed `1037` chimeras from your dataset.
#> → It took `2.46205997467041` seconds to detect and remove the chimeras.
strollur
#> rchime reference example:
#>
#> starts ends nbases ambigs polymers numns numseqs
#> Minimum: 1 249 249 0 3 0 1.00
#> 2.5%-tile: 1 252 252 0 4 0 3190.45
#> 25%-tile: 1 252 252 0 4 0 31904.50
#> Median: 1 253 253 0 4 0 63809.00
#> 75%-tile: 1 253 253 0 5 0 95713.50
#> 97.5%-tile: 1 254 254 0 6 0 124427.55
#> Maximum: 1 256 256 0 8 0 127618.00
#> Mean: 1 252 252 0 4 0 63809.14
#>
#> scrap_summary:
#> type trash_code unique total
#> 1 sequence chimeras_rchime 787 1037
#>
#> Number of unique seqs: 5297
#> Total number of seqs: 127618
#>
#> Total number of samples: 20
#> Total number of custom reports: 1
data_frame_results <- rchime(data_df, reference = reference)
#> → rchime detected `1037` chimeras in your dataset.
#> → It took `2.4663610458374` seconds to detect the chimeras.The rchime() function returns a list containing the
results of the function. When you are running the command with a
strollur object, the chimera_report is added, and chimeras are removed
for you automatically. Let’s take a closer look at the results
returned.
The chimera_report is a data.frame with a row for each sequence in your dataset. Let’s take a look at the first 5 chimeric sequences in the report:
strollur_results$chimera_report[
strollur_results$chimera_report$Chimeric_Status == "Y",
] |> head(n = 5)
#> Score Query ParentA
#> 14 0.3524927 M00967_43_000000000-A3JHG_1_2107_6538_14332 S000013923
#> 18 0.4054292 M00967_43_000000000-A3JHG_1_2108_19687_26893 S000008023
#> 21 0.3314002 M00967_43_000000000-A3JHG_1_2113_21308_17042 S000015682
#> 23 0.3266551 M00967_43_000000000-A3JHG_1_2110_13110_1977 S000260075
#> 30 0.6744335 M00967_43_000000000-A3JHG_1_1109_10514_23344 7000004128490675
#> ParentB Top_Parent QM QA QB QAB
#> 14 S000022285 S000022285 89.03509 80.70175 82.01754 77.63158
#> 18 7000004128504291 S000008023 94.82072 93.22709 77.29084 77.68924
#> 21 S000017014 S000015682 97.98387 96.37097 85.88710 84.67742
#> 23 7000004128191216 S000260075 95.93496 94.30894 79.26829 76.42276
#> 30 7000004131498332 7000004128490675 94.42231 88.84462 77.68924 74.10359
#> QT LY LN LA RY RN RA Div Chimeric_Status
#> 14 82.01754 22 6 14 19 0 5 7.017544 Y
#> 18 93.22709 46 2 10 4 0 1 1.593625 Y
#> 21 96.37097 32 2 0 4 0 3 1.612903 Y
#> 23 94.30894 45 4 6 4 0 0 1.626016 Y
#> 30 88.84462 45 3 3 15 1 7 5.577689 YResults also contains a list of the names of the chimeric sequences. Let’s get the names of the first 10 chimeras.
strollur_results$chimeras |> head(n = 10)
#> [1] "M00967_43_000000000-A3JHG_1_2107_6538_14332"
#> [2] "M00967_43_000000000-A3JHG_1_2108_19687_26893"
#> [3] "M00967_43_000000000-A3JHG_1_2113_21308_17042"
#> [4] "M00967_43_000000000-A3JHG_1_2110_13110_1977"
#> [5] "M00967_43_000000000-A3JHG_1_1109_10514_23344"
#> [6] "M00967_43_000000000-A3JHG_1_2111_20856_13433"
#> [7] "M00967_43_000000000-A3JHG_1_1110_15964_18711"
#> [8] "M00967_43_000000000-A3JHG_1_2101_14761_24747"
#> [9] "M00967_43_000000000-A3JHG_1_1114_20514_18980"
#> [10] "M00967_43_000000000-A3JHG_1_1113_26305_21260"These binaries (installable software) and packages are in development.
They may not be fully stable and should be used with caution. We make no claims about them.