Connecting data to Open Tree trees

The hardware and bandwidth for this mirror is donated by METANET, the Webhosting and Full Service-Cloud Provider.
If you wish to report a bug, or if you are interested in having us mirror your free-software or open-source project, please feel free to contact us at mirror[@]metanet.ch.

David Winter

2023-06-13

Combining data from OToL and other sources.

One of the major goals of rotl is to help users combine data from other sources with the phylogenetic trees in the Open Tree database. This examples document describes some of the ways in which a user might connect data to trees from Open Tree.

Get Open Tree IDs to match your data.

Let’s say you have a dataset where each row represents a measurement taken from one species, and your goal is to put these measurements in some phylogenetic context. Here’s a small example: the best estimate of the mutation rate for a set of unicellular Eukaryotes along with some other property of those species which might explain the mutation rate:

csv_path <- system.file("extdata", "protist_mutation_rates.csv", package = "rotl")
mu <- read.csv(csv_path, stringsAsFactors = FALSE)
mu

##                     species       mu pop.size genome.size
## 1   Tetrahymena thermophila 7.61e-12 1.12e+08    1.04e+08
## 2    Paramecium tetraurelia 1.94e-11 1.24e+08    7.20e+07
## 3 Chlamydomonas reinhardtii 2.08e-10 1.00e+08    1.12e+08
## 4  Dictyostelium discoideum 2.90e-11 7.40e+06    3.40e+07
## 5  Saccharomyces cerevisiae 3.30e-10 1.00e+08    1.25e+08
## 6       Saccharomyces pombe 2.00e-10 1.00e+07    1.25e+08

If we want to get a tree for these species we need to start by finding the unique ID for each of these species in the Open Tree database. We can use the Taxonomic Name Resolution Service (tnrs) functions to do this. Before we do that we should see if any of the taxonomic contexts, which can be used to narrow a search and avoid conflicts between different codes, apply to our group of species:

library(rotl)
tnrs_contexts()

## Possible contexts:
##    Animals 
##       Birds, Tetrapods, Mammals, Amphibians, Vertebrates 
##       Arthropods, Molluscs, Nematodes, Platyhelminthes, Annelids 
##       Cnidarians, Arachnids, Insects 
##    Fungi 
##       Basidiomycetes, Ascomycetes 
##    All life 
##    Bacteria 
##       SAR group, Archaea, Excavata, Amoebozoa, Centrohelida 
##       Haptophyta, Apusozoa, Diatoms, Ciliates, Forams 
##    Land plants 
##       Hornworts, Mosses, Liverworts, Vascular plants, Club mosses 
##       Ferns, Seed plants, Flowering plants, Monocots, Eudicots 
##       Rosids, Asterids, Asterales, Asteraceae, Aster 
##       Symphyotrichum, Campanulaceae, Lobelia

Hmm, none of those groups contain all of our species. In this case we can search using the All life context and the function tnrs_match_names:

taxon_search <- tnrs_match_names(names = mu$species, context_name = "All life")
knitr::kable(taxon_search)

search_string	unique_name	approximate_match	ott_id	is_synonym	number_matches
tetrahymena thermophila	Tetrahymena thermophila	FALSE	180195	FALSE	1
paramecium tetraurelia	Paramecium tetraurelia	FALSE	568130	FALSE	1
chlamydomonas reinhardtii	Chlamydomonas reinhardtii	FALSE	33153	FALSE	1
dictyostelium discoideum	Dictyostelium discoideum	FALSE	160850	FALSE	1
saccharomyces cerevisiae	Saccharomyces cerevisiae	FALSE	356221	FALSE	1
saccharomyces pombe	Schizosaccharomyces pombe	FALSE	990004	TRUE	1

Good, all of our species are known to Open Tree. Note, though, that one of the names is a synonym. Saccharomyces pombe is older name for what is now called Schizosaccharomyces pombe. As the name suggests, the Taxonomic Name Resolution Service is designed to deal with these problems (and similar ones like misspellings), but it is always a good idea to check the results of tnrs_match_names closely to ensure the results are what you expect.

In this case we have a good ID for each of our species so we can move on. Before we do that, let’s ensure we can match up our original data to the Open Tree names and IDs by adding them to our data.frame:

mu$ott_name <- unique_name(taxon_search)
mu$ott_id <- taxon_search$ott_id

Find a tree with your taxa

Now let’s find a tree. There are two possible options here: we can search for published studies that include our taxa or we can use the ‘synthetic tree’ from Open Tree. We can try both approaches.

Published trees

Before we can search for published studies or trees, we should check out the list of properties we can use to perform such searches:

studies_properties()

## $tree_properties
##  [1] "ot:specifiedRoot"                 "ot:unrootedTree"                 
##  [3] "ot:nodeLabelTimeUnit"             "xsi:type"                        
##  [5] "ot:MRCAName"                      "ot:nodeLabelDescription"         
##  [7] "ot:nearestTaxonMRCAOttId"         "ot:reasonsToExcludeFromSynthesis"
##  [9] "ot:curatedType"                   "ot:nearestTaxonMRCAName"         
## [11] "ot:studyId"                       "ot:nodeLabelMode"                
## [13] "rootedge"                         "nodeById"                        
## [15] "tb:type.tree"                     "ot:branchLengthDescription"      
## [17] "ot:messages"                      "ot:rootNodeId"                   
## [19] "ot:inGroupClade"                  "ot:ottId"                        
## [21] "ot:branchLengthMode"              "ot:MRCAOttId"                    
## [23] "ot:ottTaxonName"                  "tb:quality.tree"                 
## [25] "tb:kind.tree"                     "ot:outGroupEdge"                 
## [27] "ntips"                            "edgeBySourceId"                  
## [29] "label"                            "meta"                            
## [31] "tb:ntax.tree"                     "ot:tag"                          
## [33] "ot:branchLengthTimeUnit"         
## 
## $study_properties
##  [1] "tb:identifier.study.tb1"       "id"                           
##  [3] "ot:taxonLinkPrefixes"          "ot:studyYear"                 
##  [5] "prism:publicationName"         "dc:title"                     
##  [7] "prism:creationDate"            "xmlns"                        
##  [9] "skos:changeNote"               "skos:historyNote"             
## [11] "ot:notIntendedForSynthesis"    "ot:otusElementOrder"          
## [13] "dc:date"                       "xhtml:license"                
## [15] "prism:startingPage"            "prism:publicationDate"        
## [17] "ot:focalCladeOTTTaxonName"     "prism:section"                
## [19] "prism:pageRange"               "ot:messages"                  
## [21] "ot:studyPublicationReference"  "ot:curatorName"               
## [23] "ot:dataDeposit"                "prism:number"                 
## [25] "ot:agents"                     "dc:publisher"                 
## [27] "treesById"                     "dcterms:bibliographicCitation"
## [29] "ot:treesElementOrder"          "prism:modificationDate"       
## [31] "tb:identifier.study"           "about"                        
## [33] "ntrees"                        "nexmljson"                    
## [35] "ot:comment"                    "dc:contributor"               
## [37] "dc:creator"                    "prism:volume"                 
## [39] "tb:title.study"                "treebaseId"                   
## [41] "prism:endingPage"              "generator"                    
## [43] "version"                       "ot:studyId"                   
## [45] "ot:candidateTreeForSynthesis"  "otusById"                     
## [47] "prism:doi"                     "dc:subject"                   
## [49] "ot:studyPublication"           "ot:focalClade"                
## [51] "ot:annotationEvents"           "ot:tag"                       
## [53] "nexml2json"

We have ottIds for our taxa, so let’s use those IDs to search for trees that contain them. Starting with our first species Tetrahymena thermophila we can use studies_find_trees to do this search.

studies_find_trees(property = "ot:ottId", value = as.character(ott_id(taxon_search)[1]))

##    study_ids n_trees                       tree_ids candidate study_year
## 1    ot_1587       1                          tree1                 2015
## 2    ot_1589       1                          tree1                 2015
## 3    ot_2037       4 tree10, tree11, tree12, tree13                 2018
## 4     ot_409       2                   tree1, tree2     tree2       2015
## 5     ot_564       1                        Tr85317   Tr85317       2015
## 6     ot_579       1                        Tr60046                 2013
## 7     ot_700       1                          tree1     tree1       2016
## 8      ot_73       1                          tree1     tree1       2013
## 9     ot_766       1                        Tr85440                 2015
## 10    ot_767       1                          tree1     tree1       2016
## 11     ot_87       1                        Tr64119   Tr64119       2014
##                                                                                                                                    title
## 1  'Phylogenomic analyses reveal subclass Scuticociliatia as the sister group of subclass Hymenostomatia within class Oligohymenophorea'
## 2  'Phylogenomic analyses reveal subclass Scuticociliatia as the sister group of subclass Hymenostomatia within class Oligohymenophorea'
## 3                                                                                                                                       
## 4                                                                         Tree of life reveals clock-like speciation and diversification
## 5     'The alveolate translation initiation factor 4E family reveals a custom toolkit for translational control in core dinoflagellates'
## 6                                       'Convergent evolution of heat-inducibility during subfunctionalization of the Hsp70 gene family'
## 7                                                                                                       'A new view of the tree of life'
## 8                                           Deep relationships of Rhizaria revealed by phylogenomics: A farewell to Haeckel’s Radiolaria
## 9                                                                                 'Bacterial proteins pinpoint a single eukaryotic root'
## 10                 'Untangling the early diversification of eukaryotes: a phylogenomic study of the evolutionary origins of Centrohelida
## 11                        'Dinoflagellate phylogeny revisited: Using ribosomal proteins to resolve deep branching dinoflagellate clades'
##                                        study_doi n_matched_trees
## 1  http://dx.doi.org/10.1016/j.ympev.2015.05.007               1
## 2  http://dx.doi.org/10.1016/j.ympev.2015.05.007               1
## 3    http://dx.doi.org/10.1038/s41586-018-0708-8               3
## 4        http://dx.doi.org/10.1093/molbev/msv037               1
## 5    http://dx.doi.org/10.1186/s12862-015-0301-9               1
## 6      http://dx.doi.org/10.1186/1471-2148-13-49               1
## 7   http://dx.doi.org/10.1038/nmicrobiol.2016.48               1
## 8  http://dx.doi.org/10.1016/j.ympev.2012.12.011               1
## 9      http://dx.doi.org/10.1073/pnas.1420657112               1
## 10      http://dx.doi.org/10.1098/rspb.2015.2802               1
## 11 http://dx.doi.org/10.1016/j.ympev.2013.10.007               1
##            match_tree_ids
## 1                   tree1
## 2                   tree1
## 3  tree10, tree13, tree11
## 4                   tree2
## 5                 Tr85317
## 6                 Tr60046
## 7                   tree1
## 8                   tree1
## 9                 Tr85440
## 10                  tree1
## 11                Tr64119
##  [ reached 'max' / getOption("max.print") -- omitted 16 rows ]

Well… that’s not very promising. We can repeat that process for all of the IDs to see if the other species are better represented.

hits <- lapply(mu$ott_id, studies_find_trees, property = "ot:ottId", detailed = FALSE)
sapply(hits, function(x) sum(x[["n_matched_trees"]]))

## [1]  51  51 128  71  17  88

OK, most of our species are not in any of the published trees available. You can help fix this sort of problem by making sure you submit your published trees to Open Tree.

A part of the synthesis tree

Thankfully, we can still use the complete Tree of Life made from the combined results of all of the published trees and taxonomies that go into Open Tree. The function tol_induced_subtree will fetch a tree relating a set of IDs.

Using the default arguments you can get a tree object into your R session:

ott_in_tree <- ott_id(taxon_search)[is_in_tree(ott_id(taxon_search))]
tr <- tol_induced_subtree(ott_ids = ott_in_tree)

## Warning in collapse_singles(tr, show_progress): Dropping singleton nodes with
## labels: mrcaott2ott276, mrcaott2ott142555, mrcaott2ott1551, mrcaott2ott7623,
## Chloroplastida ott361838, Chlorophyta ott979501, mrcaott185ott42071,
## mrcaott185ott1426, mrcaott1426ott1544, mrcaott1544ott8659, mrcaott1544ott15345,
## mrcaott1544ott9282, mrcaott9389ott818260, mrcaott9389ott23557,
## mrcaott23557ott527099, mrcaott148ott902, SAR ott5246039, Alveolata ott266751,
## Ciliophora (phylum in subkingdom SAR) ott302424, Intramacronucleata
## ott340382, mrcaott1546ott1671, Conthreep ott5248773, mrcaott1671ott16129,
## Peniculia ott1002116, Paramecium (genus in subkingdom SAR) ott568126,
## mrcaott11752ott13570, Hymenostomatia ott5257367, Tetrahymena (genus in
## subkingdom SAR) ott47284, mrcaott295406ott523463, mrcaott295406ott523462,
## Amoebozoa ott1064655, mrcaott3973ott15653, mrcaott3973ott26103,
## mrcaott26103ott273110, mrcaott26103ott229626, Dictyostelia ott835575,
## mrcaott26103ott59686, Dictyosteliales ott4008839, Dictyosteliaceae ott4008841,
## Dictyostelium ott999665, Opisthokonta ott332573, Nucletmycea ott5246132,
## Fungi ott352914, mrcaott109ott3465, mrcaott109ott67172, mrcaott109ott1423,
## mrcaott109ott69881, mrcaott109ott55157, mrcaott109ott9352, h2007-1 ott5584405,
## Dikarya ott656316, mrcaott235ott1053, Saccharomycetales ott4085960,
## Saccharomycetaceae ott989994, Saccharomyces ott908546, Schizosaccharomycetes
## ott921286, Schizosaccharomycetidae ott5670481, Schizosaccharomycetales
## ott508517, Schizosaccharomycetaceae ott990009, Schizosaccharomyces ott990008

plot(tr)

plot of chunk subtree

Connect your data to the tips of your tree

Now we have a tree for of our species, how can we use the tree and the data together?

The package phylobase provide an object class called phylo4d, which is designed to represent a phylogeny and data associated with its tips. In order to get our tree and data into one of these objects we have to make sure the labels in the tree and in our data match exactly. That’s not quite the case at the moment (tree labels have underscores and IDs appended):

mu$ott_name[1]

## $`Tetrahymena thermophila`
## [1] "Tetrahymena thermophila"

tr$tip.label[4]

## [1] "Dictyostelium_discoideum_ott160850"

rotl provides a convenience function strip_ott_ids to deal with these.

tr$tip.label <- strip_ott_ids(tr$tip.label, remove_underscores = TRUE)
tr$tip.label %in% mu$ott_name

## [1] TRUE TRUE TRUE TRUE TRUE TRUE

Ok, now the tips are together we can make a new dataset. The phylo4d() functions matches tip labels to the row names of a data.frame, so let’s make a new dataset that contains just the relevant data and has row names to match the tree

library(phylobase)
mu_numeric <- mu[, c("mu", "pop.size", "genome.size")]
rownames(mu_numeric) <- mu$ott_name
tree_data <- phylo4d(tr, mu_numeric)

And now we can plot the data and the tree together

plot(tree_data)

plot of chunk unnamed-chunk-1

Find external data associated with studies, trees and taxa from Open Tree

In the above example we looked for a tree that related species in another dataset. Now we will go the other way, and try to find data associated with Open Tree records in other databases.

Get external data from a study

Let’s imagine you were interested in extending or reproducing the results of a published study. If that study is included in Open Tree you can find it via studies_find_studies or studies_find_trees and retrieve the published trees with get_study. rotl will also help you find external. The function study_external_IDs retrieves the DOI for a given study, and uses that to gather some more data:

extra_data <- try(study_external_IDs("pg_1980"), silent = TRUE)
if (!inherits(extra_data, "try-error")) {
  extra_data
}

## External data identifiers for study 
##  $doi:  10.1016/j.ympev.2006.04.016 
##  $pubmed_id:  16762568 
##  $nucleotide_ids: vector of 58 IDs
##  $external_data_url http://purl.org/phylo/treebase/phylows/study/TB2:S1575

Here the returned object contains an external_data_url (in this case a link to the study in Treebase), a pubmed ID for the paper and a vector IDs for the NCBI’s nucleotide database. The packages treebase and rentrez provide functions to make use of these IDs within R.

As an example, let’s use rentrez to download the first two DNA seqences and print them.

library(rentrez)
seqs <- try(entrez_fetch(db = "nucleotide", id = extra_data$nucleotide_ids[1:2], rettype = "fasta"), silent = TRUE)

if (inherits(seqs, "try-error")) {
  cat("NCBI temporarily down.")
} else {
  cat(seqs)
}

## >AM181011.1 Plectroninia neocaledoniense partial 28S rRNA gene, specimen voucher G316300 (Queensland Museum)
## GCTAGCAAGCGCGTCGGTGGTTCAGCCGGCTGGTCTCGTCGAGTTGTCGGTGTGCGGATCCGAACGGACC
## GCGGCCGATGGCGTCGGCGGGCAAGCTGTGGTGCACTCTGTCGGCGTGCGCGTCAGCGTCGGTTTCGGCC
## GGACGACGAGGCGCTCGGGGAAGGTAGCTGGACCGGTCTTCGGTGCAGTGTTATAGCCCTGGGCCGCTGG
## GTTCGGCGTTTGGGACCGAGGAGAGAGATGATCGCTGCAGCGCCTGTCTCCCTCTCGAGGGGGGCTAGCC
## AGCCGCTGTTTGGGTGGCGTCACTGGCGGAGGACTGCACGCAGTGCTTCGCCGGTGGTCGTGTCCAGGCG
## GGCGGTGTGGGTATAGAGGCGCTTAGGACGCTGGCGTCCAAATGGCCGTGCGCGACCCGTCTTGAAACAC
## GGACCAAGGAGTCTAGCATGTGCGCGAGTCTTAGGGTGTGGAAGCCCTCGGGCGCAATGAAAGTGAAGGG
## CCGTCGTCTCTCGGGGCTGCGGTGTGAGGTGAGAGCCGTCGCCGTCGGGTGGCGGTGCATCATCGGCCGG
## TCCATCCTGCTCTCAGGAGGATCTGCGCAAGAGCGTGTTTGCTGGGACCCGAAAGATGGTGAACTATGCC
## TGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCA
## AATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGG
## ATAGCTGGAACTCGTCTTGACACAGTTTTATCAGGTAAAGCGAATGATTAGAGGTCTTGGGGGTGAAACA
## CCCTCAACCTATTCTCAAACTTTAAATAGGTAAGAAGCGCGACTTGCTCAATTGAAGTGGCGCGCAGTGA
## ATGTGAGTTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCTCGGTTA
## AGGTGCCCAAGTCGACGCTCATCAGACCCCAGAAAAGGTGTTGGTCGATATAGACAGCAGGACGGTGGCC
## ATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAAAATGGAT
## GGCGCTCAAGCGTCGCACCTATACCGAGCCGTCGTGGTAAATGCCAGGCCACGACGAGTAGGAGGGCGCG
## GTGGTCGTGACGCAGCCCTTGGCGCGAGCCTGGGCGAAACGGCCTCCGGTGCAGATCTTGGTGGTAGTAG
## CAAATATTCAAATGAGAGCTTTGAAGACCGAAGTGGAGAAAGGTTCCATGTGAACAGCAGTTGGACATGG
## GTTAGTCGATCCTAAGAGATAGGGAAGTTCCGTGTGAAAGTGCGCAATGCGCTTCTGTGCTGCGCGCCTC
## CTATCGAAAGGGAATCGGGTTAATATTCCCGAACCGGAAGGCGGATATCTCTGGCTCTCGGGTCAGGAGC
## GGCAACGCAAGCGTACTGCGAGACGTCGGCGGGGGCTCCGGGAAGAGTTGTCTTTTCTTTTTAACGCAGT
## CGCCATCCCTGGAATCGGTTTGCCCGGAGATAGGGTTGGCTGGCTCGGTAAAGCAGCACACTTCATGTGC
## TGTCCGGTGCGCTCTCGACGGCCCTTGAAAATCGCAGGTGTGCATCGATTCTCGCATCCGGTCGTACTCA
## TAACCGCATCAGGTCTCCAAGGT
## 
## >AM181010.1 Eilhardia schulzei partial 28S rRNA gene, specimen voucher G316071 (Queensland Museum)
## GCTAGTAATGTACGTTGGTGGTTCAGCCGGCTAGTCTTGTCGAGTCGTCGTGTGGTGGATCCGACTGGAC
## CGTCCGCGGTGGTGTCGGCGGGCGAGCTGTGGTGCACTCTACGGACGTGCGCGTCAGCGTCGGTTCTCGA
## TGGGCGATAAGGTGCGTGGGGGAAGGTGGCTCGGTCCTTGGGAACTGAGTGTTACAGACCCTGGTGCTGG
## GCTCGTCGTGGGACCGAGGAGAGAGAGAGATGATCGCTGCGGCACCTGCCCCGTTGTCATTTTTCGGGGC
## TAGCCAGCCGTTTGTCAGGTGTGCGTCGGACGTTGAGGACTGCACGCAGTGCTGGACGTGGAGGCGTGAT
## CTGATGGCGGTGTGGGCATTAGAGGTGCCTAGGACGCTGGCGTCCAAATGGCCGTGCGCGACCCGTCTTG
## AAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCTTAGGGTGTGCAAGCCCTCGGGCGCAATGAAAGT
## GAAGGCTCGGCGGCGCTAGTCGAGCTGAGGTGAGAGCCGTGGCCGTTGCATGTGGCGGCGGCGGCGCATC
## ATCGGCCGGTCCATCCTGCTCTCAGGGGGATCCGAGCAAGAGCGTATTTGTTGGGACCCGAAAGATGGTG
## AACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAAT
## CGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTT
## TCCCTCAGGATAGCTGGAGCTCTTGGACACAGTTTTATCAGGTAAAGCGAATGATCAGAGGTCTTGGGGG
## TGAAACACCCTCAACCTATTCTCAAACTTTAAATCGGTAAGAAGCGCGACTTGCTGAATTGAAGCCGCGC
## GCAAGCAATGTGAGTTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGC
## TGGGTTAAGGTGCCAAAGTCGACGCTCATCAGACCCCAGAAAAGGTGTTGGTTGATATAGACAGCAGGAC
## GATGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAA
## AATGGATGGCGCTCAAGCGTCGCACCTATACCGGGCCGTCGTCGCAAATGCCAGGCGACGACGAGTAGGA
## GGGCGCAGTGGTCGTCATGCAGCCCTTGGCGTGAGCCTGGGTCAAACGGCCTCTGGTGCAGATCTTGGTG
## GTAGTAGCAAATATTCAAATGAGAGCTTTGAAGACCGAAGTGGAGAAAGGTTCCATGTGAACAGCAGTTG
## GACATGGGTTAGTCGATCCTAAGTGATAGGGGAGCTCCGTATGAAAGTGCGCAATCGGCCCTGCTTGTGT
## CGCCTTGCGCCACCTATCGAAAGGGAATCGGGTTAATATTCCCGAACCGGAAGGCGGATTTTCTCTGGCT
## CTCGGGTCAGGAGCGGCAACGCTAGCGAACCGCGAGACGTCGGCGGGGGCTCCGGGAAGAGTTGTCTTTT
## CTTTTTAACGCAGTCGCCATCCCTGGAATCGGTTTGCCCGGAGATAGGGTTGGCTGGCTCGGTAAAGCAG
## CACACTTCATGTGCTGTCCGGTGCGCTCTCGACGGCCCTTGAAAATCGCGGCGAGTGTAGTCTGATTTTC
## GCATCCGTTCGTACTCATAACCGCATCAGGTCTCCAAGGT

You could further process these sequences in R with the function read.dna from ape or save them to disk by specifying a file name with cat.

Find a OTT taxon in another taxonomic database

It is also possible map an Open Tree taxon to a record in another taxonomic database. For instance, if we wanted to search for data about one of the tips of the sub-tree we fetched in the example above we could do so using taxon_external_IDs:

Tt_ids <- taxon_external_IDs(mu$ott_id[2])
Tt_ids

##   source       id
## 1  silva AY102613
## 2   ncbi     5888
## 3   gbif  7415807

A user could then use rgbif to find locality records using the gbif ID or rentrez to get genetic or bibliometric data about from the NCBI’s databases.

What next

The demonstration gets you to the point of visualizing your data in a phylogenetic context. But there’s a lot more you do with this sort of data in R. For instance, you could use packages like ape, caper, phytools and mcmcGLMM to perform phylogenetic comparative analyses of your data. You could gather more data on your species using packages that connect to trait databases like rfishbase, AntWeb or rnpn which provides data from the US National Phenology Network. You could also use rentrez to find genetic data for each of your species, and use that data to generate branch lengths for the phylogeny.

These binaries (installable software) and packages are in development.
They may not be fully stable and should be used with caution. We make no claims about them.