The hardware and bandwidth for this mirror is donated by METANET, the Webhosting and Full Service-Cloud Provider.
If you wish to report a bug, or if you are interested in having us mirror your free-software or open-source project, please feel free to contact us at mirror[@]metanet.ch.

stringmagic 1.2.0

Compatibility with old R versions

Bugs

New operators

dna = string_split("atagggagctacctgcgcgtcgcccaaaagcaggg", "")
cat_magic("Letters in the DNA seq. {''c, Q ? dna}: ",
          # by default: inverse frequency sorting
          "  -      default: {table, enum ? dna}",
          "  - value sorted: {table.sort, enum ? dna}",
          # argument in single quotes to customize the display, it's a 
          #   `string_magic` interpolation
          "  -       shares: {'{x} [{round(s * 100)}%]' table, enum ? dna}",
          # `fsort` sorts by **increasing** frequency
          "  - freq. sorted: {'{q ? x}' table.fsort, enum ? dna}",
          .sep = "\n")
#> Letters in the DNA seq. "atagggagctacctgcgcgtcgcccaaaagcaggg": 
#>   -      default: g (12), c (10), a (9) and t (4)
#>   - value sorted: a (9), c (10), g (12) and t (4)
#>   -       shares: g [34%], c [29%], a [26%] and t [11%]
#>   - freq. sorted: 't', 'a', 'c' and 'g'
x = c(153, 207.256, 0.00254, 15231312.2)
# keeping one significant digit
cat_magic("v1: {s1, align ? x} ",
          # removing the comma for large numbers and preserving ints
          "v2: {s1.int.nocomma ? x}", .collapse = "\n")
#> v1: 153.0        v2: 153
#> v1: 207.2        v2: 207.2
#> v1: 0.002        v2: 0.002
#> v1: 15,231,312.2 v2: 15231312.2

string_magic("pi = {r3 ? pi}")
#> [1] "pi = 3.142"

New features

User visible change: Functions renaming

Minor changes

stringmagic 1.1.2

Hot fix

New features

stringmagic 1.1.1

Hot fix

stringmagic 1.1.0

New functions

Improvements

x = "Hi Mary, how's John doing?"
from = "John"
to = "Kate"
string_clean(x, "m/{from} => {to}")
#> [1] "Hi Mary, how's Kate doing?"
data = list(x = c(15, 25, 550), y = rnorm(1000))
string_magic("The values are{& length(data$x) < 5 ; : {enum ? .} ;  too many}.")
# [1] "The values are: 15, 25 and 550."
string_magic("The values are{& length(data$y) < 5 ; : {enum ? .} ;  too many}.")
# [1] "The values are too many."

Aliases

stringmagic 1.0.0

First public release. The syntax should be stable.

This package is a spinoff from fixest’s formula syntax interpolation.

Many thanks to Achim Zeileis, Vincent Arel-Bundock and Kyle Butts who provided insightful comments during the development.

These binaries (installable software) and packages are in development.
They may not be fully stable and should be used with caution. We make no claims about them.