The hardware and bandwidth for this mirror is donated by METANET, the Webhosting and Full Service-Cloud Provider.
If you wish to report a bug, or if you are interested in having us mirror your free-software or open-source project, please feel free to contact us at mirror[@]metanet.ch.

stringmagic 1.2.0

Compatibility with old R versions

• stringmagic is now fully compatible with R v3.5.0 (at least)

Bugs

• fix major bug in the if-else operator (&) leading to opposite operations

• in string_vec, fix bug leading to the removal of empty strings

• in string_vec, fix bugs with the arguments .sep and .collapse

• in C code: use STRING_PTR_RO instead of STRING_PTR to comply with new CRAN policy

New operators

• string_magic: new operator table to flexibly attach elements with their frequencies:

dna = string_split("atagggagctacctgcgcgtcgcccaaaagcaggg", "")
cat_magic("Letters in the DNA seq. {''c, Q ? dna}: ",
          # by default: inverse frequency sorting
          "  -      default: {table, enum ? dna}",
          "  - value sorted: {table.sort, enum ? dna}",
          # argument in single quotes to customize the display, it's a 
          #   `string_magic` interpolation
          "  -       shares: {'{x} [{round(s * 100)}%]' table, enum ? dna}",
          # `fsort` sorts by **increasing** frequency
          "  - freq. sorted: {'{q ? x}' table.fsort, enum ? dna}",
          .sep = "\n")
#> Letters in the DNA seq. "atagggagctacctgcgcgtcgcccaaaagcaggg": 
#>   -      default: g (12), c (10), a (9) and t (4)
#>   - value sorted: a (9), c (10), g (12) and t (4)
#>   -       shares: g [34%], c [29%], a [26%] and t [11%]
#>   - freq. sorted: 't', 'a', 'c' and 'g'

• string_magic: new operators round and signif (wtih shorthands r0 to r6 and s0 to s6) to flexibly format numbers:

x = c(153, 207.256, 0.00254, 15231312.2)
# keeping one significant digit
cat_magic("v1: {s1, align ? x} ",
          # removing the comma for large numbers and preserving ints
          "v2: {s1.int.nocomma ? x}", .collapse = "\n")
#> v1: 153.0        v2: 153
#> v1: 207.2        v2: 207.2
#> v1: 0.002        v2: 0.002
#> v1: 15,231,312.2 v2: 15231312.2

string_magic("pi = {r3 ? pi}")
#> [1] "pi = 3.142"

New features

• add the argument .data to string_magic(), used to evaluate variables in the interpolations

• new functions get_interpolated_expr() and get_interpolated_vars(). This function recovers all the expressions to be interpolated in a call to string_magic() (oriented for developers).

• new argument center.right in the function string_fill to resolve situations in which the characters are not perfectly centered

• make cat_magic and message_magic more in line with their base R counterparts (they work properly with vectors now)

User visible change: Functions renaming

• the functions st_ops, st_is, st_any, st_all have been renamed into stops, stis, stany, stall to align with the convention of all other aliases. Although the names aren’t great, at least they are consistent.

Minor changes

• the new operator swidth (screen width) replaces the operator width. The operator width becomes an alias for fill.

• the default screen width for message_magic becomes the minimum between 100 characters and 90% of the current screen size (actually the console size).

• rework the argument .width in message_magic and cat_magic: now the special variable .sw can only be used in a one-sided formula (non-standard evaluation is still supported for retro-compatibility)

• improve error handling

• add left option to operators when relevant. Thanks to @kylebutts, #3

• in string_vec, change the default of argument .protect.vars to FALSE, which is much more aligned to common sense

• in string_magic’s argument .post: removal of argument catching, which could lead, occasionnally, to bugs very hard to understand

• in string_vec: add the arguments .check and .help.

stringmagic 1.1.2

Hot fix

• make stringmagic compatible with R in [4.1.0; 4.1.2].

New features

• add argument .trigger to cat/message_magic_alias

stringmagic 1.1.1

Hot fix

• make stringmagic compatible with R < 4.1.0 by removing calls to ...names().

stringmagic 1.1.0

New functions

• add string_extract to extract patterns

• add string_split to split character strings

Improvements

• string_ops now uses ... to pass operations. This is backward compatible.

• string_clean: now the magic flag also expands the replacements:

x = "Hi Mary, how's John doing?"
from = "John"
to = "Kate"
string_clean(x, "m/{from} => {to}")
#> [1] "Hi Mary, how's Kate doing?"

• string_magic: add the comma flag to the enum operation. In that case, the enumeration ends with “,” instead of “, and”.

• string_magic: the if-else operation & now keeps memory of variables accessed within data sets:

data = list(x = c(15, 25, 550), y = rnorm(1000))
string_magic("The values are{& length(data$x) < 5 ; : {enum ? .} ;  too many}.")
# [1] "The values are: 15, 25 and 550."
string_magic("The values are{& length(data$y) < 5 ; : {enum ? .} ;  too many}.")
# [1] "The values are too many."

• string_magic: new operation deparse (alias: dp) to deparse an object and keep only the first characters of the deparsed string.

• improve error messages.

Aliases

• new battery of short aliases: sma for string_magic, catma for catmagic, mema for message_magic, etc.. (st_ops, st_is, st_any, st_all, stextract, stwhich, stget, stclean, stvec, streplace, stsplit – short names with vowels after st have an underscore.)

stringmagic 1.0.0

First public release. The syntax should be stable.

This package is a spinoff from fixest’s formula syntax interpolation.

Many thanks to Achim Zeileis, Vincent Arel-Bundock and Kyle Butts who provided insightful comments during the development.

These binaries (installable software) and packages are in development.
They may not be fully stable and should be used with caution. We make no claims about them.